0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: Biosynthesis of platelet glycoprotein V expressed as a single subunit or in association with GPIb-IX doc

Báo cáo khoa học: Biosynthesis of platelet glycoprotein V expressed as a single subunit or in association with GPIb-IX doc

Báo cáo khoa học: Biosynthesis of platelet glycoprotein V expressed as a single subunit or in association with GPIb-IX doc

... Biosynthesis of platelet glycoprotein V expressed as a single subunit or in association with GPIb-IX Catherine Strassel, Sylvie Moog, Marie-Jeanne Baas, Jean-Pierre Cazenave and Franc¸ois LanzaINSERM ... have been proposed for glycoprotein (GP) V . It could act as a negative regulator of thrombinactivation [6], or as an a ccessory receptor for collagendependent platelet adhesion and a ctivation ... thesupernatants revealed a positive signal starting at 60 min of chase a nd having a molecular mass (82 kDa) consistent with a f ully mature form. This b and was not observed in the celllysates a t a...
  • 7
  • 363
  • 0
Tài liệu Báo cáo khoa học: Biosynthesis of riboflavin Screening for an improved GTP cyclohydrolase II mutant pdf

Tài liệu Báo cáo khoa học: Biosynthesis of riboflavin Screening for an improved GTP cyclohydrolase II mutant pdf

... for their increa sed V maxvalue also showed anincrease in their Kmvalue.The increased Kmvalues of the mutant constructsmay be caused predominantly by an increased off-ratefor dissociation ... reaction velocity was increased(via accelerated product release, as described earlier).For the practical purpose of improving the produc-tivity of a riboflavin-overproducing strain by intro-ducing ... BamH1sites of pQE60 (Table 1). The gene itself was slightly modi-fied by the addition of the DNA sequence motif 5¢-GAATTCattaaagaggagaaattaact ATG AGA GGA TCT CACCAT CAC CAT CAC CAT GGG ATC GAT CAT-3¢...
  • 11
  • 487
  • 0
Báo cáo khoa học: Biosynthesis of riboflavin 6,7-Dimethyl-8-ribityllumazine synthase of Schizosaccharomyces pombe pot

Báo cáo khoa học: Biosynthesis of riboflavin 6,7-Dimethyl-8-ribityllumazine synthase of Schizosaccharomyces pombe pot

... for d etection of the mutations are underlined.Designation Endonuclease Sequence A- 1 5¢ ataatagaattcattaaagaggagaaattaactatgttcagtggtattaaaggccctaac 3¢ A- 2 5¢ tattatggatccttaatacaaagctttcaatcccatctc ... tattatggatccttaatacaaagctttcaatcccatctc 3¢W27G SacII 5¢ aaaggccctaacccttcagacttaaagggaccagaattgcgcattcttattgtccatgcccgcggtaatcttcaag 3¢W27I AseI5¢ aaaggccctaacccttcagacttaaagggaccagaattgcgcattcttattgtccatgcccgcattaatcttcaag ... aaaggccctaacccttcagacttaaagggaccagaattgcgcattcttattgtccatgcccgcattaatcttcaag 3¢W27S AsuII 5¢ aaaggccctaacccttcagacttaaagggaccagaattgcgcattcttattgtccatgcccgttcgaatcttcaag 3¢W27H SacI5¢ aaaggccctaacccttcagacttaaagggaccagagctccgcattcttattgtccatgcccgccataatcttcaag...
  • 8
  • 343
  • 0
Báo cáo khoa học: Biosynthesis of isoprenoids – studies on the mechanism of 2C-methyl-D-erythritol-4-phosphate synthase pdf

Báo cáo khoa học: Biosynthesis of isoprenoids – studies on the mechanism of 2C-methyl-D-erythritol-4-phosphate synthase pdf

... drug was aborted in the 1980s, but recent work has shown activity againstvarious Plasmodium spp., including Plasmodium fal-ciparum, a major human pathogen [17,20–22]. Thesestudies have validated ... near-permanent basis.The residual enzyme activity after 24 h of incubationwas measured after massive dilution of an aliquot of the reaction mixture, using 1 as substrate. The decrease in activity ... IspC as a target for the develop-ment of novel antimalarial agents, which are urgentlyneeded in light of the enormous death toll of malaria[23] and the rapid dissemination of variants with...
  • 14
  • 534
  • 0
Báo cáo khoa học: Biosynthesis of isoprenoids A bifunctional IspDF enzyme fromCampylobacter jejuni pot

Báo cáo khoa học: Biosynthesis of isoprenoids A bifunctional IspDF enzyme fromCampylobacter jejuni pot

... tuberculosis and Mycobacteriumleprae as well as in the v arious Plasmodium species causingmalaria. Recent studies have already shown that malaria canbe treated by the antibiotic fosmidomycin, an inhibitor ... Sequence (5¢-3¢)IspDF Forward ACGCATATGAGTGAAATGAGCCTTATTATGTTAIspDF Reverse GCTGGATCCTCATAATCTTGTCCAATCAAAATAFig. 1. Deoxyxylulose phosphate pathway for the biosynthesis of isoprenoids.Ó FEBS ... tructureformulas, the13C labels are indicated b y filledsquares and ba rs connecting adjacent13Catoms.Table 3. Activation of the catalytic domains of recombinant IspDFprotein by divalent metal...
  • 8
  • 305
  • 0
Báo cáo khoa học: Biosynthesis of riboflavin in Archaea 6,7-Dimethyl-8-ribityllumazine synthase of Methanococcus jannaschii pdf

Báo cáo khoa học: Biosynthesis of riboflavin in Archaea 6,7-Dimethyl-8-ribityllumazine synthase of Methanococcus jannaschii pdf

... 5¢-GGAGAAATTAACCATGGTATTGATGGTAAATCTTGG-3¢MJ-RibE-2 BamHI 5¢-TTCTTTGGAAGGGATCCAATTTCATAAAAATTT-3¢MJ-RibE-3 EcoRI 5¢-ACACAGAATTCATTAAAGAGGAGAAATTAACTATG-3¢BS-RibH-DN-G6 EcoRI, NcoI5¢-ATAATAGAAGAATTCATTAAAGAGGAGAAATTAACCATGGGAAATTTAGTTGGTACAG-3¢BS-RibH-2 ... NcoI5¢-ATAATAGAAGAATTCATTAAAGAGGAGAAATTAACCATGGGAAATTTAGTTGGTACAG-3¢BS-RibH-2 BamHI 5¢-TATTATGGATTCTTATTCGAAAGAACGGTTTAAG-3¢Fig. 1. Terminal reactions in the pathway of riboflavin biosynthesis. 1026 I. Haase ... B.J., Viitanen, P .V. & San-dalova, T. (1999) Crystal structure analysis of a pentameric fungaland icosahedral plant lumazine synthase reveals the structuralbasis of diferences in assembly....
  • 8
  • 300
  • 0
Báo cáo khoa học: Modulation of P-glycoprotein-mediated multidrug resistance by acceleration of passive drug permeation across the plasma membrane potx

Báo cáo khoa học: Modulation of P-glycoprotein-mediated multidrug resistance by acceleration of passive drug permeation across the plasma membrane potx

... the incorporation of drugs into the inner leaflet of the plasma membraneand ⁄ or accelerate its lateral transport to the Pgp. Tranet al. [29] have analyzed the kinetic parameters of Pgp-mediated ... estimate Pgp activity.The capacity of the surface-active agents to accelerate passive drug trans-bilayer movement was not correlated with their fluidizing characteristics,measured as fluorescence ... chloroform and various non-ionic detergents [10,15] accelerate passive movement of doxorubicin across artificial membranes. As the inhibi-tion of Pgp ATPase activity exerted by the variousagents was...
  • 11
  • 313
  • 0
Báo cáo khoa học: Biosynthesis of D-arabinose in mycobacteria – a novel bacterial pathway with implications for antimycobacterial therapy pdf

Báo cáo khoa học: Biosynthesis of D-arabinose in mycobacteria – a novel bacterial pathway with implications for antimycobacterial therapy pdf

... of Cg-emb in Corynebacterineae leads to a novel truncated cellwall arabinogalactan, whereas inactivation of Cg-ubiA results in an arabinan-deficient mutant with a cell wall galactan core. J Biol ... synthesis of d-arabinose, butrather inhibits the incorporation of d-arabinofurano-syl residues of decaprenyl-phospho-arabinose into thearabinogalactan and (lipo)arabinomannan of themycobacterial ... cell wall and of some glycerol-based glycolipids [26]. The branchedarabinan chains of the arabinogalactan are attached tothe linear galactan backbone. The arabinan consists of an inner linear...
  • 21
  • 572
  • 0
Tài liệu Báo cáo khoa học: Role of the cag-pathogenicity island encoded type IV secretion system in Helicobacter pylori pathogenesis pptx

Tài liệu Báo cáo khoa học: Role of the cag-pathogenicity island encoded type IV secretion system in Helicobacter pylori pathogenesis pptx

... CagA-independent pathways involved in the activation of receptor and non-RTKs, pro -in ammatory signalling, RhoGTPase activation, scattering and motility of gastric epithelial cells, as well as ... factor -a or IL-8, have been associated with anincreased risk of developing disease, including gastriccancer, as summarized in excellent review articles[1–3,5] (more details are also provided in Doc. ... ⁄ Abl and ⁄ or phosphoinositide-3-kinase mayalso activate the small Rho GTPases Cdc42 and Rac1,and binding of CagAPYto Grb2, or Shp2 may regulateproliferative and pro -in ammatory signalling...
  • 13
  • 866
  • 0
Tài liệu Báo cáo khoa học: Modulation of sterol homeostasis by the Cdc42p effectors Cla4p and Ste20p in the yeast Saccharomyces cerevisiae pptx

Tài liệu Báo cáo khoa học: Modulation of sterol homeostasis by the Cdc42p effectors Cla4p and Ste20p in the yeast Saccharomyces cerevisiae pptx

... the in vitroactivity of acyl-CoA:ergosterol acyltransferase wasdetermined in an are1 deletion background. Theenzyme activity in the ste20D strain and the cla4D strainwas indistinguishable ... of SE in cla4D cells could beexplained by a negative regulation of Are2p activity byCla4p. Alternatively, Are2p activity may be normal in cells lacking CLA4, and increased amounts of SE mightsimply ... domains are com-partmentalized in the plasma membrane and serve as an anchor for proteins involved in establishing cellpolarity [28,59]. However, the existence and biochemi-cal nature of such...
  • 12
  • 699
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnchuyên đề điện xoay chiều theo dạngGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Thơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ