Biosynthesis of isoprenoids A bifunctional IspDF enzyme from Campylobacter jejuni Mads Gabrielsen 1 , Felix Rohdich 2 , Wolfgang Eisenreich 2 , Tobias Gra¨ wert 2 , Stefan Hecht 2 , Adelbert Bacher 2 and William N. Hunter 1 1 Division of Biological Chemistry and Molecular Microbiology, School of Life Sciences, University of Dundee, UK; 2 Lehrstuhl fu ¨ r Organische Chemie und Biochemie, Technische Universita ¨ tMu ¨ nchen, Garching, Germany In the nonmevalonate pathway of i soprenoid biosynthesis, the conversion of 2 C-methyl- D -erythritol 4-phosphate into its cyclic diphosphate proceeds via nucleotidyl intermediates and is catalyzed by the products of the ispD, ispE and ispF genes. An open reading frame of Campylobacter jejuni with similarity to the ispD and ispF genes of Escherichia coli was cloned into an expression vector directing the formation of a 42 k Da protein in a recombinant E. coli strain. The purified protein w as shown t o c atalyze the transformation of 2C-met hyl- D -erythritol 4-phosphate into 4-diphospho- cytidyl-2C-met hyl- D -erythritol and the conversion of 4-diphosphocytidyl-2C-methyl- D -erythritol 2-phosphate into 2C-methyl- D -erythritol 2,4-cyclodiphosphate at cata- lytic rates of 19 lmol Æmg )1 Æmin )1 and 7 lmolÆmg )1 Æmin )1 , respectively. Both enz yme-catalyzed reactions require diva- lent metal i ons. The C. jejuni enzyme does not catalyze the formation of 2C-methyl- D -erythritol 3,4-cyclophosphate from 4-diphosphocytidyl-2C-methyl- D -erythritol, a side reaction catalyzed in vitro by the IspF proteins of E. coli and Plasmodium falciparum. Comparative genomic analysis show that all sequenced a-ande-proteobacteria have fused ispDF genes. These bifunctional proteins a re potential drug targets in several human pathogens (e.g. Helicobacter pylori, C. jejuni and Treponema pallidum). Keywords: b ifunctional e nzyme; biosynthetic pathway; isoprenoid; NMR; nonmevalonate. Isoprenoids are one of the largest groups of n atural products comprising numerous compounds with important roles in physiological and pathological processes [1]. The early work with yeast and animal cells established t he biosynthesis of the two universal isoprenoid building blocks, isopentenyl diphosphate (9, F ig. 1 ) a nd dim ethylallyl diphosphate (10, F ig. 1), f rom acetyl-CoA via mevalonate [2–5]. This pioneering work culminated in the development of important drugs, most notably inhibitors of 3-hydroxy-3- methylglutaryl-CoA reductase inhibitors (statins), which are now widely used for the prevention and therapy of cardiovascular disease [ 6,7]. About a decade ago, a second pathway for the f ormation of 9 and 10 from pyruvate (1)and D -glyceraldehyde 3-phosphate ( 2) v ia 1- deoxy- D -xylulose 5 -phosphate (3) was found to be operative in certain bacteria as well as in the plastids of plants and protozoa [8–12]. The first committed intermediate of this pathway, 2C-methyl- D -erythritol 4-phosphate (4), is formed from 3 by a skeletal r earrange- ment followed by reduction; both reaction steps are catalyzed by the IspC protein (Fig. 1) [13]. The polyol 4 is converted into t he cyclic diphosphate 7 via 4-diphospho- cytidyl-2C-met hyl- D -erythritol (5) and its 2 -phosphate 6 by the consecutive action of three enzymes specified by the ispD, E and F genes [14–16]. The conversion of 7 into 9 and 10 via t he recently identified intermediate 1-hydroxy-2- methyl-2-(E)-butenyl 4-diphosphate (8) requires IspG and IspH proteins [ 17–24]. The nonmevalonate pathway for the biosynthesis of terpenoids is essential in a wide variety of pathogenic bacteria including Mycobacterium tuberculosis and Mycobacterium leprae as well as in the v arious Plasmodium species causing malaria. Recent studies have already shown that malaria can be treated by the antibiotic fosmidomycin, an inhibitor of the IspC protein [25,26]. Hence, it appears safe to c onsider the enzymes o f the nonmevalonate pathway as estab lished therapeutic targets. T he detailed c haracterization of a ll enzymes of this pathway is required in order to provide a firm basis for the screening and development of novel drugs. Here we describe the catalytic properties of the bifunctional IspDF protein f rom t he human pathogen, Campylobacter jejuni. Experimental procedures Materials [1,3,4- 13 C 3 ]4 was prepared as described earlier [27]. The preparation of [ 1,3,4- 13 C 3 ]6 will be described elsewhere (A. Bacher, F. Rohdich, W. Eisenreich, E. Ostrojenkova, J. Kaiser & T. Gra ¨ wert, unpublished data). Sodium [1,2- 13 C 2 ]acetate was purchased from Isotec (Miamisburg, OH, USA). CTP, ATP, phosphoenolpyruvate and pyruvate kinase were obtained from S igma. Oligonucleotides were custom synthesized by Sigma Genosys. Restriction enzymes, Pfu polymerase and DNA ligase w ere purchased from Promega. DNaseI was obtained f rom Roche. Protease Correspondence to W . N. Hunter, Division of B iological Chemistry and Molecular Microbiology, Sc hool of Life Sciences, Uni versity of Dundee, Dundee, DD1 5EH, UK. Fax: + 44 1382 345764, Tel.: + 44 1382 345745, E-mail: w.n.hunter@dundee.ac.uk (Received 17 March 2004, revised 25 M ay 2004, accepted 28 May 2004) Eur. J. Biochem. 271, 3028–3035 (2004) Ó FEBS 2004 doi:10.1111/j.1432-1033.2004.04234.x inhibitor cocktail was from Roche. Thr ombin was obtained from Amersham Pharmacia Biotech. Recombinant IspE protein from Escherichia coli was prepared as described earlier [ 15]. Microorganisms and plasmids Bacterial strains and plasmids used in this study are s hown in Table 1. Cloning and expression of the ispDF gene from C. jejuni The putative ispDF open r eading frame was amplified fr om bp position 49 226–50 340 (GenBank accession number AL139079) by PCR using the oligonucleotides IspDF Forward and IspDF Reverse (Table 2) as primers and C. jejuni DNA as template. The amplicon, comprising engineered restriction sites for NdeIandBamHI, was cloned into the pCR-Blunt II TOPO vector [28] (Invitrogen). Positive clones were identified by d igestion with Nde Iand BamHI affording a 1.1 kb fragment that was cloned into the pET15b expression vector (Novagen). The integrity of the cloned gene was confirmed by sequencing. The resulting plasmid pET15b-ispDF was heat-shock transformed into the E. coli strain BL21 (DE3) [29], giving the recombinant strain BL21-pET15b-ispDF. Enzyme purification The recombinant E. coli strain BL21-pET15b-ispDF was grown i n Luria–Bertani broth containing am picillin Table 1. Bacterial strains and plasmids use d in this study. Strain or plasmid Genotype or relevant characteristic Ref. or source Escherichia coli BL21(DE3) F – , ompT, hsdS B (r B – m B – ), gal, dcm (DE3) [29], Novagen Plasmids pCR-Blunt II TOPO High-copy vector for direct cloning of PCR fragments [28], Invitrogen pET15b High-copy vector for N-terminal His-tag hyperexpression Novagen pET15b-ispDF Expression of ispDF from Campylobacter jejuni as N-terminal His-tag fusion protein This study Table 2. Oligonucleotides used in this study. Restriction s ites are underlined.Startandstopcodonsareshowninbold. Designation Sequence (5¢-3¢) IspDF Forward ACG CATATGAGTGAAATGAGCCTT ATTATGTTA IspDF Reverse GCT GGATCCTCATAATCTTGTCCAAT CAAAATA Fig. 1. Deoxyxylulose phosphate pathway for the biosynthesis of isoprenoids. Ó FEBS 2004 The bifunctional enzyme IspDF (Eur. J. Biochem. 271) 3029 (100 mgÆL )1 ). Cultures were incubated at 37 °Cwith shaking. At an attenuance of 0.8 (600 n m), isopropyl thio- b- D -galactoside was added to a final concentration of 1 m M , and the culture was incubated at room temperature overnight. The cells were harvested by centrifugation (25 m in, 3500 g)at4°C. Bacterial c ell mass ( 2 g ) was suspended in 2 0 m L of 100 m M Tris/HCl, pH 7 .7, containing 50 m M NaCl, lyso- zyme (4 mgÆmL )1 ), benzamidine (4 mgÆmL )1 ), 1 tablet of protease inhibitor cocktail (Roche) and 7 0 units of DNaseI (Roche). The suspension was passed through a French press and was then centrifuged (25 min, 39 200 g,4°C). The supernatant was passed through a 0.2 lm fi lter and was then appliedtoa5mLmetalchelatingHiTrapcolumn(Amer- sham Pharmacia Biotech) preloaded with nickel chloride and equilibrated with 100 m M Tris/HCl, pH 7.7, containing 50 m M NaCl. T he column was washed with 25 m M bistris propane, pH 7 .6, containing 10 m M imidazole and was then developed with a gradient of 10–1000 m M imidazole. Frac- tions were analyzed by SDS/PAGE, combined and dialyzed against 100 m M Tris/HCl, pH 8.5, containing 50 m M NaCl. The protein concentration was determined spectrophoto- metrically using an extinction coefficient of 2 6 000 M )1 Æcm )1 (280 nm). Thrombin (Amersham Pharmacia Biotech) was added to a final concentration of 6.7 units per mg of protein. The mixture was incubated overnight at room temperature, passed through a 0.2 lm filter, and placed on a Sepharose Q anion exchange column (Amersham Pharmacia Biotech) which was developed with a gra dient of 0– 1000 m M NaCl. Fractions we re combined, dialyzed against 100 m M Tris/ HCl, pH 8.0, and c oncentrated by ultrafiltration. Glycerol was added t o a final concentration of 1% (v/v). The solution was s tored at )20 °C. NMR assay for IspD activity A solution containing 100 m M Tris/HCl,pH8,10m M MgSO 4 ,7.7m M [1,3,4- 13 C 3 ]4,7.7m M CTP, 10% ( v/v) D 2 O and protein ( total volume, 600 lL) was i ncubated in an NMR t ube at 37 °C. 13 C NMR spectra were recorded at intervals. NMR assay for IspF activity A solution containing 100 m M Tris/HCl, pH 8, 10 m M MgSO 4 ,7.7m M [1,3,4- 13 C 3 ]6,10%(v/v)D 2 O and protein (total volume, 600 lL) was incubated in an N MR tube at 37 °C. 13 C NMR spectr a were recorded at intervals. Fig. 2. Amino acid s equence a lignment o f t he bifunctional IspDF pro tein f rom C. jejuni and monofuntional IspD and IspF proteins from E. coli. Residues i nvolved in substrate binding [31–33] are lab eled by triangles; conserved r esidues are shown in grey, identical residues in black. Fig. 3. Purification o f r ecombinant IspDF p rotein from C. jejuni. (A) molecular mass m arkers; (B) c ell extract of recombinant E. coli BL21- pET15b-ispDF hyperexpressing the is pD F gene from C. jejuni;(C) recombinant I spDF o f C. j ejuni protei n after n ickel c helatin g affinity chromatography; D, recombinant IspDF after thrombin treatment and a nion exchange chromatography on Sepharose Q . 3030 M. Gabrielsen et al.(Eur. J. Biochem. 271) Ó FEBS 2004 Kinetic studies on recombinant IspDF protein by NMR spectroscopy 13 C NMR signal intensities w ere used t o perform numerical simulations using t he program DYNAFIT [30]. Protein sequencing N-terminal sequencing was performed b y Edman degrada- tion using a PE B iosystems M odel 492 (Weiterstadt, Germany). Mass Spectrometry Experiments were carried out with a Voyager MALDI-TOF mass spectrometer (Amersham Biosciencees, Inc.) using a sinapinic acid matrix. IspDF protein from C. jejuni was used as 0.1% (w/v) s olution in 50 m M Tris/HCl, pH 8.0. NMR spectroscopy 13 C NMR spectra were r ecorded with an AVANCE 500 spectrometer from Bruker Instruments (Karlsruhe, Germany). Composite pulse decoupling was used during acquisition and relaxation. The s ignals of 4, 5, 6 and 7 were assigned earlier [14–16,27]. The concentrations of the substrates were determined by internal standardization with sodium [1,2- 13 C 2 ] acetate. Results A database search with the ispD and ispF genes of E. coli identified an open reading frame of C. jejuni,acausative agent f or gastroenteritis in humans, from the a-proteobac- teria g roup, specifying a putative bifunctional IspDF fusion protein (Fig. 2). Notably, however, the similarity of the hypothetical C. jejuni gene to ispF is higher t han the similarity to ispD. Many residues previously shown to be part of the catalytic sites of the IspD and IspF proteins Fig. 4. 13 C NMR signals obtained from a reaction mixture before (A) and after incubation (B)of[1,3,4- 13 C 3 ]2C-methyl- D -erythritol 4- phosphate with recombinant IspDF protein. The mixture contained 100 m M Tris, pH 8.0, 7.7 m M CTP, 7.7 m M [1,3,4- 13 C 3 ]2C-m ethyl- D -erythritol 4-phosphate and IspDF protein from C. jejuni after nickel chelating affinit y chromatography. The mixture was incubated at 37 °Cand 13 C NMR spectra were recorded at 0 min (A) and 30 min ( B). 13 C coupling patterns o f [1,3,4- 13 C 3 ]2C-methyl- D -erythritol 4-phosphate ( 4) and [1,3,4- 13 C 3 ]4-diphospho- cytidyl-2C-methyl- D -erythritol (5)areindica- ted in (A) and ( B), respectively. In the s tructure formulas, the 13 C labels are indicated b y filled squares and ba rs connecting adjacent 13 Catoms. Table 3. Activation of the catalytic domains of recombinant IspDF protein by divalent metal ions. Th e reaction mixtures were prepared and analyzed as described under E xperime ntal proc edure s. T he fi nal con- centration of ea ch metal io n was 1 m M . The fin al concentrations of Mg 2+ and E DTA were 10 m M . Metal ion Relative activities (%) IspD domain IspF domain Zn 2+ 100 77 Mn 2+ 96 64 Ni 2+ 90 < 5 Mg 2+ 90 77 Cu 2+ 90 < 5 Fe 2+ 87 54 Ca 2+ 86 100 Co 2+ 84 76 Mg 2+ 82 94 EDTA < 5 < 5 Table 4. Kinetic properties of r ecombinant IspDF p rotein from Cam- pylobacter jejuni. The reaction mixtures were pre pared and analyzed as described under Exp erimental procedures. Property IspD domain IspF domain Specific activity (lmolÆmin )1 Æmg )1 )19 7 Turnover number (s )1 per subunit) 13 5 K m (l M ) for CTP a 3– K m (l M ) for 2C-methyl- D -erythritol 4-phosphate b 20 – K m (l M ) for 4-diphosphocytidyl- 2C-methyl- D -erythritol 2-phosphate c –19 a Reaction mixtures containing 100 m M Tris/HCl, pH 8, 1 m M ZnCl 2 , 21.8 m M [1,3,4- 13 C 3 ]4, 4.2 m M CTP, 10% (v/v) D 2 O and 0.2 l M protein (total volume, 600 lL) were incubated in an NMR tube at 37 °C. 13 C NMR spectra were recorded at intervals of 8 min. b Reaction mixtures containing 100 m M Tris/HCl, pH 8, 1m M ZnCl 2 , 11.7 m M [1,3,4- 13 C 3 ]4,60m M CTP, 10% (v/v) D 2 O and 1.6 l M protein (total volume, 600 lL) were incubated in an NMR tube at 37 °C. 13 C NMR spectra were recorded at intervals of 8 min. c Reaction mixtures containing 100 m M Tris/HCl, pH 8, 1m M CaCl 2 , 19.3 m M [1,3,4- 13 C 3 ]6, 10% (v/v) D 2 O and 3.3 l M protein (total volume, 600 lL) were incubated in an NMR tube at 37 °C. 13 C NMR spectra were recorded at intervals of 8 min. Ó FEBS 2004 The bifunctional enzyme IspDF (Eur. J. Biochem. 271) 3031 [31–33], respectively, a re conserved i n t he hypothetical C. jejuni protein (Fig. 2). The hypothetical ispDF open r eading frame o f C. jejuni was placed under the control o f a T 7 promoter and lac operator in the hyperexpression plasmid pET-15b as described under Experimental procedures. The gene was preceded by a synthetic DNA segment specifying t he amino acid motif MGSS(H) 6 SSGLVPRGSH designed to enable the purification of the r ecombinant protein via metal chelating affinity chromatography. In a r ecombinant E. coli strain, this plasmid directed the synthesis of a protein with an apparent mass of about 44 kDa as judged by SDS/PAGE (Fig. 3, lane B). Cell extracts of this strain showed catalytic activities for IspD and IspF o f 3.9 and 0 .8 lmolÆmin )1 Æmg )1 , respect- ively. The recombinant protein was purified by affinity chromatography on a nickel c helating column (Fig. 3, lane C). The polyhistidine tag was removed by thrombin-medi- ated proteolysis, and the resulting IspDF protein domain was purified to apparent homogeneity by anion exchange chromatography (Fig. 3, lane D). The purified protein had a relative mass of 42 kDa as judged by polyacrylamide gel electrophoresis. MALDI-TOF m ass spectrometry afforded a relative mass of 41 870 Da, in close agreement with the calculated mass o f 41 971 Da . Edman deg radation afforded the N-terminal s equence GSHMSEMSLIM LAAGNSTRFNTKVK where the N-terminus of the wild-type IspDF protein was preceded by the s egment GSH, a r emnant of the polyhistidine tag. The catalytic act ivity of the recombinant IspDF protein was studied by 13 C NMR spectroscopy. For reasons of limited stability, the following kinetic assays were performed with the polyhistidine tagged fusion protein. In order to enhance the sensitivity and selectivity of 13 C observation, we used m ultiply 13 C-labeled substrates. I ncubation of the recombinant IspDF protein with [1,3,4- 13 C 3 ]2C-methyl- D - erythritol 4-phosphate (4)andCTPat37°C afforded [1,3,4- 13 C 3 ]4-diphosphocytidyl-2C-methy l- D -erythritol (5) (Fig. 4 B; all 13 C NMR signals and 13 C 13 C coupling constants of 4 and 5 have been reported earlier, [14]). The optimum pH for this reaction w as pH 5. The IspD domain was catalytically active in the presence of various divalent metal ions (Table 3). Highe st rates of 18 .5 lmolÆmin )1 Æmg )1 were found with Zn 2+ .TheK m values for CTP a nd 4 were 3 l M and 20 l M , respectively ( Table 4 ). Fig. 5. 13 C NM R signals o btained f rom a reaction mixture before (A) and after incubation (B)of[1,3,4- 13 C 3 ]2C-met hyl- D -erythritol 4 - phosphate with recombinant IspD F and IspE proteins. The mixture co ntained 100 m M Tris pH 8.0, 3 m M ATP, 9 m M phosphoenolpyru- vate, 10 m M CTP, and 10 m M [1,3,4- 13 C 3 ]2C- methyl- D -erythritol 4-phosphate, 9 U of pyruvate kinase, 0.2 U of IspE protein from E. coli and IspDF from C. jejuni (total volume 600 lL). The mixture was inc ubated at 37 °C and 13 C NMR spectra were record ed a t 0 m in (A) a nd 3.5 h (B). 13 C c oupling patterns of [1,3,4- 13 C 3 ]2C-m ethyl- D -erythritol 4-phos- phate (4) a nd [1,3,4- 13 C 3 ]2C-m ethyl- D -erythr- itol 2,4-cyclodiphosphate (7)areindicatedin (A) a nd (B), respectively. Fig. 6. 13 C NM R signals o btained f rom a reaction mixture before (A) and after incubation (B)of[1,3,4- 13 C 3 ]4-diphosphocytidyl-2C-me- thyl- D -erythritol 2-phosphate w ith r ecombinant IspDF protein. The mixture contained 100 m M Tris pH 8.0, 7.7 m M [1,3,4- 13 C 3 ]4-diphospho- cytidyl-2C-methyl- D -erythritol 2-phosphate and IspDF protein from C. jej uni after nickel chelating affinity chrom atograph y. The mix- ture was incubated at 37 °C. 13 CNMRspec- tra were recorded at 0 min (A) and 30 min (B). 13 C c oupling patterns of [1,3, 4- 13 C 3 ]4- diphosphocytidyl-2C-methyl- D -erythritol 2-phosphate (6) and [1,3,4- 13 C 3 ]2C-meth yl- D -erythritol 2 ,4-cyclodiphosp hate (7)are indicatedin(A)and(B),respectively. 3032 M. Gabrielsen et al.(Eur. J. Biochem. 271) Ó FEBS 2004 The addition of ATP to the reaction mixture described above did no t detectably affect the course of the reaction. However, when ATP was added together with the IspE protein of E. coli, 13 C NMR spectroscopy showed the formation of [ 1,3,4- 13 C 3 ]2C-met hyl- D -erythritol 2,4-cyclo- diphosphate ( 7) as shown in F ig. 5 . T he chemical shifts as well as the 13 C 13 C coupling constants were i n excellent agreement with t he published data o f 7 [16]. In order to measure the rate of formation of the cyclic diphosphate 7 from the d irect precursor, 4-diphosphocyt- idyl-2C-methyl- D -erythritol 2 -phosphate ( 6), the recombin- ant IspDF protein was incubated w ith [1,3,4- 13 C 3 ]6 (Fig. 6). The catalytic IspF domain was most active at pH 8. The protein requires the presence of a divalent metal ion (Table 3); highest a ctivities of 6.6 lmolÆmin )1 Æmg )1 (Table 4) were found with Ca 2+ .Ni 2+ and Cu 2+ could not serve as cofactors. The K m value for 6 was 19 l M (Table 4). A systematic a nalysis o f the genomic localization of ispD and ispF genes in bacteria was performed using the STRING database designed for a nalysis of f unctional associations between proteins [34]. Data from t he genomes of 50 bacterial species are displayed in Fig. 7. Ten eubacteria in that collection specify bifunctional ispDF genes. In 28 species, ispD and ispF genes are directly adjacent a nd may form part of an oper on. In all cases of fused ispD and ispF domains as well as of directly linked ispD and ispF genes, the ispD module is i nvariably located at the 5¢ end of t he ensemble. Notably, all a-ande-proteobacteria studied have fused ispDF genes s pecifying bifunctional enzymes, and all b-andc-proteobacteria studied have adjacent genes speci- fying monofunctional e nzymes. Discussion Antibiotic resistance in virtually all pathogenic bacteria now constitutes a major public health hazard worldwide and creates an u rgent need f or novel anti-infective strategies. A large f raction of eubacteria including m any serious human pathogens, for example the food-borne Campylobacter jejuni which causes gastroenteritis [35,36], use exclusively the nonmevalonate pathway for the biosynthesis of terpe- noids, and the enzymes of the pathway are essential for their survival [18,37,38]. B ecause these enzymes do not occur in vertebrates, they are attractive therapeutic targets. It should also be noted that the m alaria causing Plasmodium species use the no nmevalonate pathway exclusively and can be treated with f osmidomycin, an i nhibitor of 2 C-methyl- D -erythritol 4-phosphate synthase [25,26]. Clustering of ispD and ispF genes h as been reported earlier a nd has p layed an important role in the elucidation of the nonmevalonate pathway [14,16]. A detailed analysis of sequence similarity and topology of the ispD and ispF genes afforded the dendrogram i n Fig. 7 . R emarkably, all a-ande-proteobacteria studied feature b ifunctional IspDF enzymes. However, bifunctional enzymes are not a unique feature of proteobacteria and are also found in the genetically distant Spirochetes. The putative bifunctional IspDF enzymes h ave not been studied pr eviously in any detail. We chose the enzyme from the human pathogen for the present s tudy with the expectation that information on nonmevalonate pathway enzymes from human pathogens may serve as t he basis for antibiotic development. Fig. 7. Phylogenetic occurrence of the ispD and ispF ge nes in d ifferent bacterial species. Fused, linked and unlinked ispD and ispF genes are indicated b y different a rrows. Table 5. Catalytic properties of IspD and IspF proteins from various o rganisms. ND, not d etermined. Organism IspD domain IspF domain Reference Specific activity (lmolÆmin )1 Æmg )1 ) K m (l M ) Specific activity (lmolÆmin )1 Æmg )1 ) K m (l M ) Campylobacter jejuni 19 3 a ,20 b 7 19 This study Escherichia coli 23 3 a , 131 b 2.5 ND [39,40] Arabidopsis thaliana 67 114 a , 500 b ND ND [39] Plasmodium falciparum ND ND 4 252 [41] a Determined for CTP. b Determined for 2C-methyl- D -erythritol 4-phosphate. Ó FEBS 2004 The bifunctional enzyme IspDF (Eur. J. Biochem. 271) 3033 The catalytic p roperties of the IspD and IspF domains of the bifunctional C. jejuni enzyme are similar to those of the orthologous, monofunctional enzymes from various organ- isms (Table 5) [38–40]. Whereas the IspF enzymes of E. coli and Plasmodium falcip arum catalyze a side reaction condu- cive to the formation of 2C-methyl- D -erythritol-3,4- cyclo- monophosphate [16,40], the C. jejuni enzyme exclusively forms 2C-methyl- D -erythritol 2,4-cyclodiphosphate ( 7). Acknowledgements We thank Jane Turner a nd Brendan Wren for supplying the genomic DNA of C. jejuni and Angelika Werner and Fritz W endling for expert h elp with the pre paration of the manuscript. This work was supported by the Wellcome Trust, the Deutsc he Forschungsgemeinsc- haft, the Fonds der Chemischen Industrie and the Hans-Fischer- Gesellschaft. References 1. Sacchettini, J.C. & Poulter, C.D. (1997) Creating isoprenoid diversity. Science 277, 1788–1789. 2. Bach, T.J. ( 1995) Som e new aspects of isoprenoid biosynthesis in plants – a re view. Lipids 30, 191–202. 3. Bloch, K. (1992) Sterol molecule: structure, biosynthesis, and function. Steroids 57, 378 –382. 4. Bochar, D.A., Friesen, J.A., Stauffacher, C.V. & Rodwell, V.W. (1999) Biosynthesis of mevalonic acid from acetyl-CoA. In Com- prehensive Natural Product Chemistry (Cane, D., ed.), Vol. 2, pp. 15–44. Pergamon, Oxford. 5. Qureshi, N. & Porter, J.W. (1981) Biosynthesis of mevalonic acid from acetyl-CoA. In Biosynthesis of Isoprenoid Compounds (Por- ter, J.W. & Spurgeon, S.L., eds), Vol. 1, pp. 47–94. John Wiley, New York. 6. Slater, E . & M acDonalds, J.S. ( 1988) Mechanism o f action a nd biological profile of HMG CoA reductase inhibitors. A new therapeutic alternative. Drugs 36, 72–82. 7. Stancu, C . & Sima , A. (2001) Statins: mechanism of a ction and effects. J. Cell Mol. Med. 5, 3 78–387. 8. Schwarz, M. & Arigoni, D. (1999) Ginkgolide biosynthesis. In Comprehensive Natural Product Chemistry (Cane, D., ed.) , Vol. 2, pp. 367–399. Pergamon, O xford. 9. Rohmer, M. (1999) A mevalonate-independent route to isopen- tenyl d iphosphate. I n Comprehensive N atural Product C hemistry (Cane, D ., ed.), Vol. 2, pp. 45–68. Pergamon, Oxford. 10. Eisenreich, W ., Schwarz, M., Cartayade, A., Arigoni, D., Ze nk, M.H. & Bacher, A. (1998) The deoxyxylulose phosphate pathway of terpenoid biosynthesis in plants a nd microorganism s. Chem. Biol. 5, R221–R233. 11. Rohdich, F., Hecht, S., Bacher, A. & Eisenreich, W. (2003) Deoxyxylulose phosphate p athway of isopre noid b iosynthesis. Discovery a nd fun ction of ispD EFGH genes and their cognate enzymes. Pure Appl. Chem. 75, 393–405. 12. Eisenreich, W., Bacher, A., Arigoni, D. & Rohdich, F. (2004) Biosynthesis of isoprenoids via the non-mevalonate pathway. Cell. Mol. Life Sci. 61, 1401–1426. 13. Takahashi, S., Kuzuyama, T., Watanabe, H. & Seto, H. (1998) A 1-deoxy- D -xylulose 5 -phosphate reductoisomerase c atalyzing the formation of 2C-meth yl- D -erythritol 4-ph osphate in an alternative nonmevalonate pathway for terpenoid biosynthesis. Proc. Natl Acad. Sci. USA 95 , 9879–9884. 14. Rohdich, F., Wungsintaweekul, J., Fellermeier, M., Sagner, S., Herz, S., Kis, K., Eisenreich, W., Bacher, A. & Zenk, M.H. (1999) Cytidine 5¢-triphosphate-dependent biosynthesis of isoprenoids: YgbP protein o f Escherichia coli catalyzes the fo rmation of 4-diphosphocytid yl-2C-methylerythritol. Proc. N atl Acad. Sci. USA 96 , 11758–11763. 15. Lu ¨ ttgen, H., Rohd ich, F ., H erz, S., Wungsintaweekul, J., H echt, S.,Schuhr,C.A.,Fellermeier,M.,Sagner,S.,Zenk,M.H.,Bacher, A. & Eisenreich, W. (2000) Biosynthesis of terpenoids: YchB protein of Escherichia coli ph osphorylates the 2-h ydroxy group of 4-diphosphocytid yl-2C-methyl- D -erythritol. Proc. N atl Acad. Sc i. USA 97 , 1062–1067. 16. Herz,S.,Wungsintaweekul,J.,Schuhr,C.A.,Hecht,S.,Lu ¨ ttgen, H.,Sagner,S.,Fellermeier,M.,Eisenreich,W.,Zenk,M.H., Bacher, A. & Rohdich, F. ( 2000) Biosynthesis of terpenoids: YgbB protein c on verts 4-diphosp hocytidyl- 2C-methyl- D -erythritol 2 - phosphate to 2C-methyl- D -erythritol 2,4-cyclodiphosphate. Proc. NatlAcad.Sci.USA97, 2486–2490. 17. Hecht, S., Eisenreich, W., Adam, P., Amslinger, S., Kis, K., Bacher, A., Arigoni, D. & Rohdich, F. (2001) Studies on the nonmevalonate pathway to terpenes: the role of the GcpE (IspG) protein. Proc. Natl A cad. Sci. USA 98, 1 4837–14842. 18. Altincicek, B., Kollas, A., Eberl, M., Wiesner, J., Sanderbrand, S., Hintz,M.,Beck,F.&Jomaa,H.(2001)LytB,anovelgeneofthe 2C-methyl- D -erythritol 4-phosphate pathway of isoprenoid bio- synthesis in Escherichia c oli. FEBS Lett. 499, 3 7–40. 19. Wolff, M., Seemann, M., Grosdemange-Billiard, C., Tritsch, D., Campos, N., Rodriguez-Concep cion, M., Boronat, A. & Rohmer, M. (2002) Isoprenoid biosynthesis via the methylerythritol phos- phate pathway. (E)-4-hydroxy-3-methylbut-2-enyl diphosphate: chemical synthesis and formation from methylerythritol cyclodi- phosphate by a cell-free system from Escherichia coli. Tetrahedron Lett. 43 , 2555–2559. 20. Rohdich, F., Hecht, S., Ga ¨ rtner, K., Adam, P., Krieger, C., Amslinger,S.,Arigoni,D.,Bacher,A.&Eisenreich,W.(2002) Studies on the nonmevalonate terpene biosynthetic pathway: metabolic role of IspH (LytB) pr otein. Proc. Natl Acad. Sci. USA 99, 1158–1163. 21. Adam, P., Hecht, S., Eisenreich, W., Kaiser, J., Gra ¨ wert, T., Arigoni, D., Bacher, A. & Rohdich , F. (2002) Biosynthesis of terpenes: studies on 1-hydroxy-2-methyl-2-(E)-butenyl 4-dipho- sphate re du ctase. Proc.NatlAcad.Sci.USA99, 12108–12113. 22. Altincicek, B., Duin , E .C., Reichenberg, A., H edderich, R., Kol- las, A.K., H intz, M., Wagner, S., Wiesner, J., B eck, E. & Jomaa, H. (2002) L ytB p rotein ca talyzes the terminal step of the 2C-me- thyl- D -erythritol-4-phosphate pathway of isoprenoid biosynthesis. FEBS Lett. 532, 437 –440. 23. Kollas, A.K., Duin, E.C., Eberl, M., Altincicek, B., H intz, M ., Reichenberg, A., Henschker, D., Henne, A., Stein brecher, I., Ostrovsky, D.N., Hedderich, R ., Beck, E ., Jomaa, H. & Wiesner, J. (2002) Functional ch aracterization of G cpE , an essential enzyme of the n on-m evalonate pathway of isoprenoid biosynth- esis. F EBS Lett. 532, 432–436. 24. Rohdich,F.,Zepeck,F.,Adam,P.,Hecht,S.,Kaiser,J.,Laupitz, R., Gra ¨ wert, T., Amslinger, S., Eisenreich, W., Bacher, A. & Arigoni, D. (2003) The deoxyxylulose phosphate pathway of isoprenoid biosynthesis: studie s on the mechanisms of the r eac- tions catalyzed by IspG a nd Isp H protein. Proc.NatlAcad.Sci. USA 10 0 , 1586–1591. 25. Jomaa, H., Wiesner, J., Sanderbrand, S., Altinicicek, B., Wei- demeyer,C.,Hintz,M.,Tu ¨ rbachova,I.,Eberl,M.,Zeidler,J., Lichtenthaler, H.K., S oldati, D. & Be ck, E. (1999) Inhibitors o f the nonmevalonate path way o f isop renoid bio synthesis a s a nti- malarial drugs. Science 285, 1573–1576. 26. Missinou, M.A., Borrmann, S., S chindler, A., Issifou, S., A deg- nika, A.A., Matsiegui, P B., Binder, R., Lell, B., Wiesner, J., Baranek, T., J omaa, H. & Kremser, P.G. (2002) Fosmidomycin for m alaria. Lancet 360, 1941–1942. 27. Hecht, S., Wungsintaweekul, J., Rohdich, F., Kis, K., Rad- ykewicz, T., Schu hr, C.A., Eisenreich , W., Richte r, G. & Bacher, 3034 M. Gabrielsen et al.(Eur. J. Biochem. 271) Ó FEBS 2004 A. (2001) Biosynthesis of terpenoids: efficient multistep biotransfo rmat ion procedures affording isotope-labeled 2C- methyl- D -erythritol 4-phosphate using recom binant 2C-methyl- D -erythritol 4 -phosphate synthase. J. Org. Chem. 66, 7 770–7775. 28. Shuman, S. (1994) Novel approach to molecular cloning and polynucleotide synthesis u sing vaccinia DNA t opoisomerase. J. Bio l . Chem. 269, 32678–32684. 29. Studier, F.W., Ro senberg, A.H., Dunn, J .J. & Dubendorf, J.W. (1990) Use of T7 RNA-polymerase to direct expression o f cloned genes. Methods Enzymol. 185, 60–89. 30. Kuzmic, P. (1996) Program DYNAFIT for the analysis of enzyme kinetic data: application t o HIV proteinase. Anal. B iochem. 237, 260–273. 31. Kemp, L.E., Bond, C.S. & Hunter, W.N. (2002) Structure of 2 C- methyl- D -erythritol 2,4-cyclodiphosphate synthase: an essential enzyme for isoprenoid biosynthe sis and target for antimicrob ial drug de velop ment. Proc.NatlAcad.Sci.USA14, 65491–66596. 32. Kemp,L.E.,Bond,C.S.&Hunter,W.N.(2003)Structureofa tetragonal c rystal form of E s cherichia coli 2C-methyl- D -erythritol 4-phosphate cytidylyltransferase. Acta Crystallogr. D Biol. Crys- tallogr. 59, 607–610. 33. Steinbacher, S., Kaiser, J., Wungsintaweekul, J., Hecht, S., Eisenreich,W.,Gerhardt,S.,Bacher,A.&Rohdich,F.(2002) Structure of 2C-methyl- D -erythritol-2,4-cyclodiphosphate syn - thase involved in mevalonate-independent biosynthesis of iso - prenoids. J. Mol. Biol . 316, 7 9–88. 34. von Mering, C., Huynen, M., Jaeggi, D., Schmidt, S., Bork, P. & Snel, B. (2003) STRING: a datab ase of predicted fu nctional associations between proteins. Nu cleic A cids Res. 31 , 258 –261. 35. Park, S.F. (2002) The physiology of Campylobacter species and its relevance to their role as foodborne pathogens. Int. J. Food Microbiol. 74 , 177–188. 36. Bourke, B. (2002) Campylobacter infection: small bowel and colon. Curr. O pin. Gastroent. 18,4–9. 37. Cunningham, F.J. Jr, Lafond, T.P. & Gantt, E. (2000) Evidence of a role for LytB in the nonmevalonate pathway of isoprenoid biosynthesis. J. Bacteriol. 182, 5841–5648. 38. Campos, N., Rodriguez-Concepcion, M., Seemann, M., Rohmer, M. & Boronat, A. (2001) Identification of gcpE as a novel gene of the 2C-methyl- D -erythritol 4-phosphate pathway for isoprenoid biosynthesis in Escherichia coli. FE BS Lett. 48 8 , 170–173. 39. Rohdich, F., Wungsintaweekul, J., Eisenreich, W., Richter, G., Schuhr, C.A., Hecht, S., Zenk, M.H. & Bacher, A. (2 000) Bi o- synthesis of terpenoids: 4-diphosphocytidyl-2C-methyl- D -ery- thritol synthase of Arabidopsis thaliana. Proc.NatlAcad.Sci.USA 97, 6451–6456. 40. Schuhr, C.A., Hecht, S., Eisenreich, W., Wungsintawe ekul, J., Bacher, A . & Rohdich, F. (2001) Studies on the non-mevalonat e pathway – Preparation and properties of isotope-labeled 2C- methyl- D -erythritol 2 ,4-cyclodiphosphate. Eur. J. Org. Chem. 3221–3226. 41. Rohdich, F., Eisenreich, W., Wungsintaweekul, J., Hecht, S., Schuhr, C.A., Zenk, M.H. & Bacher, A. ( 2001) B iosynthesis o f terpenoids. 2C-Methyl- D -erythritol 2,4-cyclodiphosphate synthase (IspF) fro m Plasmodium falciparum . Eur. J. Biochem. 268, 3190– 3197. Ó FEBS 2004 The bifunctional enzyme IspDF (Eur. J. Biochem. 271) 3035 . prevention and therapy of cardiovascular disease [ 6,7]. About a decade ago, a second pathway for the f ormation of 9 and 10 from pyruvate (1)and D -glyceraldehyde 3-phosphate. ites are underlined.Startandstopcodonsareshowninbold. Designation Sequence (5¢-3¢) IspDF Forward ACG CATATGAGTGAAATGAGCCTT ATTATGTTA IspDF Reverse GCT GGATCCTCATAATCTTGTCCAAT CAAAATA Fig.