Báo cáo khoa học: Human salivary a-amylase Trp58 situated at subsite )2 is critical for enzyme activity potx
Báo cáo khoa học: Human salivary a-amylase Trp58 situated at subsite )2 is critical for enzyme activity potx
... 11,127–128.Ó FEBS 2004 Trp58 mutants at subsite )2 of human salivary a-amylase (Eur. J. Biochem. 271) 2529 Human salivary a-amylase Trp58 situated at subsite )2 is critical for enzyme activity Narayanan ... mediate the information flow duringsubstrate binding and catalysis [13]. The conformationadopted by the loop structure in W58L is another snapshot for different possible conformations that can ... suggest that the residue Trp58 plays a critical role in substrate binding and hydrolytic activity of human salivary a-amylase. Keywords: salivary a-amylase; site-directed mutagenesis; subsite engineering;...
- 13
- 396
- 0
Tài liệu Báo cáo khoa học: The SCO2299 gene from Streptomyces coelicolor A3(2) encodes a bifunctional enzyme consisting of an RNase H domain and an acid phosphatase domain pdf
... intermediate, which is essen-tial for their catalysis [33,34]. A His residue in anRHGXRXP motif that is highly conserved amongAPases has been proposed to form this intermediate[34]. His301 in the ... phosphate.One unit (U) of phosphatase activity is defined as theamount of enzyme resulting in the production of 1 lmolphosphate per min at 37 °C. The specific activity is definedas the enzymatic activity ... starting from the ini-tiator Met for each protein. An asterisk indi-cates a conserved His residue proposed toform a phophohistidine enzyme intermedi-ate. The abbreviations are as follows: Sco,SCO2299...
- 10
- 561
- 1
Báo cáo khoa học: Caspase-8- and JNK-dependent AP-1 activation is required for Fas ligand-induced IL-8 production ppt
... (Z-YVAD-fmk), suggesting that thecatalytic activity of caspase-8 was important for FasL-induced JNK activation.DiscussionIn this study, we demonstrated that AP-1 activation is required for optimal IL-8 ... apoptosis after FasL treatment. Using thissystem, we recently discovered that caspase-8-mediatedcell-autonomous NF-jB activation is crucial for thisresponse [10]. In addition, we found that FasL ... the catalytic activity of ca-spase-8 is required for FasL-induced AP-1 activation.The JNK signaling pathway is required for FasL-induced AP-1 activation and IL-8 productionFasL activates three...
- 9
- 362
- 0
Báo cáo khoa học: Essential role of the C-terminus in Melanocarpus albomyces laccase for enzyme production, catalytic properties and structure pdf
... PAGE(Fig. 2). The ABTS activity for pool 1 (430 nkatÆmg)1)was consistently slightly lower than that for pool 2(520 nkatÆmg)1). Pool 2 was therefore used for charac-terization. Table 1 presents ... site was dis-turbed. The His140, which is coordinated to the T3copper, is slightly rotated as compared with the native enzyme, and it forms a hydrogen bond with a watermolecule instead of a ... analysis using graphpad prism software 4.01(GraphPad Software, Inc., San Diego, CA, USA). For inhibitor studies, the enzyme was preincubated for 2 min at room temperature with various concentrations...
- 16
- 452
- 0
Báo cáo khoa học: ATP-binding domain of heat shock protein 70 is essential for its effects on the inhibition of the release of the second mitochondria-derived activator of caspase and apoptosis in C2C12 cells potx
... have shown that the ATP-bindingdomain of HSP70 is essential for its anti-apoptotic role. For example, deletional analysis demonstrated thatthe ATP-binding domain is essential for inhibitingthe ... Furthermore, theATP-binding domain of HSP70 is critical for sequester-ing AIF in the cytosol [29]. In the present study, wedemonstrated that the ATP-binding domain of HSP70was indispensable for inhibition ... the medium at a final concentration of 0.5 mm.Heat shock treatmentSubconfluent cultured cells in 50-mm dishes were subjectedto hyperthermia of 42 ± 0.3 °C for 1 h in a water bathbefore being...
- 10
- 726
- 0
Báo cáo khoa học: A hydrophobic segment within the C-terminal domain is essential for both client-binding and dimer formation of the HSP90-family molecular chaperone pptx
... J. Biochem. 270) 151therefore, it is still ambiguous whether the regions, especiallythe region responsible for dimer formation and that for client binding, exist at distinct sites of the C-terminal ... This issue is now under investigationin our laboratory.AcknowledgementsWe greatly appreciate Drs D. Ladant (Pasteur Institute, Paris, France)and L. Selig (Hybrigenics S.A., Paris, France) for ... we assumedthat formation of the complex of the region carrying thehydrophobic segment of GRP94 is mediated via its client-binding activity. To settle this issue, we reinvestigated thedomain–domain...
- 9
- 364
- 0
Báo cáo khoa học: A cocaine insensitive chimeric insect serotonin transporter reveals domains critical for cocaine interaction ppt
... for generating chimeras.Restrictionsite PrimersKpnI5¢-TTAGAAGGTACCCCATTGTATGGGATC(forward)NdeI5¢-ACGCATATGTTACCAGAATGGAGGCGGT(forward)5¢-CGCCATATGTAGGGGAATCGCCACACGT(reverse)NsiI5¢-ATAATGCATCACTCTCTGGAAACGGATC(forward)BglII ... 5¢-TGGTCATCACCTGCTACTTTGGATCCCTGGTCACCCTGAC (forward)5¢-GTCAGGGTGACCAGGGATCCAAAGTAGCAGGTGATGACCA (reverse)F515V F to V 5¢-GTCGCTGTGTCTTGGGTCTATGGCATCACTCAGTTCTGCAGGG (forward)5¢-CCCTGCAGAACTGAGTGATGCCATAGACCCAAGACACAGCGAC ... obsessive–compulsive disorder, and possiblypanic disorder, eating disorders, obesity and alcoholism[1,2].The major mechanism by which serotonin action in thesynaptic cleft is terminated is by its removal...
- 11
- 408
- 0
Tài liệu Báo cáo khoa học: Human Cdc45 is a proliferation-associated antigen pdf
... indicates thatCdc45 is relatively stable in proliferating human cells.Indeed, the stabilizing residue methionine is found at the N-terminus of the human Cdc45 protein(NCBI NP 003495). This is ... proteins in human cells, supporting the concept that origin bindingof Cdc45 is rate limiting for replication initiation. We also show that theCdc45 protein level is consistently higher in human cancer-derived ... nonprolifer-ating states. Our data highlight that Cdc45 is a prolif-eration-associated antigen that becomes undetectablein long-term quiescent, terminal differentiated and sen-escent human cells....
- 16
- 504
- 0
Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx
... CTTCTGGCTGCCTCACTCCGCGCGATATCGCAAGATGGCGGACATCTCCCTGGCTCAAAGCTTGATTTTGAATTCTGTGpCR2.1 ⁄ PDIP46(2) ⁄ SKAR(b) CTTCTGGCTGCCTCACTCCGCGCGATATCGCAAGATGGCGGACATCTCCCTGGCTCAAAGCTTGATTTTGAATTCTGTGpHybLex ⁄ Zeo-ER GCGGAATTCTCTCACACCATTTTGCTGGTGCGCTCGAGTTATTTCCCAGCCTGTTGGGCCTGpQE30 ... activation of HIS3 and lacZTable 1. Primer sets for construction of plasmids used in this study.Plasmid Primer setpCR2.1 ⁄ ER ATTTCATCTAATACAGTCGCGGGATCCACGATGTCTCACACCATTTTGCGCGGAATTCTTATTTCCCAGCCTGTTGGGCCTGpCR2.1 ... GCGGGATCCCACACCATTTTGCTGGTACAATAAGAATGCGGCCGCCTATTTCCCAGCCTGTTGGGCCTGpGEX-4T1 ⁄ PDIP46 ⁄ SKAR(L7) GCGGGATCCAACAAGGAAGAACCCCCCATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGpEGFP-N1 ⁄ ER GCGAAGCTTCACGATGTCTCACACCATTTGCGGGATCCCGTTTCCCAGCCTGTTGGGCCTpEGFP-N1...
- 14
- 517
- 0
Tài liệu Báo cáo khoa học: Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines A possible strategy for the maintenance of intracellular heme level pdf
... differen-tiation arrest in mice [35]. These results indicate thatheme is essential for differentiation of erythroid cells. Inthis context, our preliminary data suggest that treatment for 48 h ... andevidence for their separate regulation. J Biochem(Tokyo) 113, 214–218.10 Takeda K, Ishizawa S, Sato M, Yoshida T & ShibaharaS (1994) Identification of a cis-acting element that is responsible for ... Sendai, Japan3 Department of Biochemistry, Yamagata University School of Medicine, Yamagata, JapanHeme oxygenase (HO) is the rate-limiting enzyme inheme catabolism and cleaves heme to release iron,...
- 12
- 621
- 0
Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018chuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)MÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ