Báo cáo khoa học: Ixocarpalactone A isolated from the Mexican tomatillo shows potent antiproliferative and apoptotic activity in colon cancer cells pot
Báo cáo khoa học: Ixocarpalactone A isolated from the Mexican tomatillo shows potent antiproliferative and apoptotic activity in colon cancer cells pot
... Journal 273 (2006) 5714–5723 ª 2006 The Authors Journal compilation ª 2006 FEBS 5723 Ixocarpalactone A isolated from the Mexican tomatillo shows potent antiproliferative and apoptotic activity in ... cancer cells. To investigate the effects of IxoA on apoptosis, weused acridine orange ⁄ ethidium bromide staining and DAPI staining and found a marked increase in the per-centage of apoptotic cells ... fruits and vegetables and increased intake of meats and fats [5–7]. Westerniza-tion of diets, or greater intake of meats and fats, hasbeen linked with an increased incidence of colon can-cer,...
- 10
- 310
- 0
Báo cáo khoa học: Nitric oxide formation from the reaction of nitrite with carp and rabbit hemoglobin at intermediate oxygen saturations pdf
... O2affinity. The reaction of nitrite with fully oxygenated carpHb at 100% So2was clearly autocatalytic. The reac-tion rate initially showed a sharp increase, reached a marked peak and then displayed a ... stabilization by ATP and the effects ofchanges in O2tension ⁄ saturation during the reaction. The data revealed that the reactivity is dynamically in uenced by oxygen affinity and the allosteric ... deconvolution instead proposed the transient appearance of small amounts ofdeoxyHb and HbNO (fitting artifacts) during the autocatalytic phase (Fig. 2F). In order to study how an increase in oxygenationin...
- 13
- 462
- 0
Tài liệu Báo cáo khoa học: Regulation of connective tissue growth factor (CTGF/CCN2) gene transcription and mRNA stability in smooth muscle cells Involvement of RhoA GTPase and p38 MAP kinase and sensitivity to actin dynamics docx
... stempting to speculate that interactions between monomericG-actin and actin-binding proteins are a potential target ofregulation by RhoA GTPase.Furthermore, our data indicated that RhoA-mediatedCTGF/CCN2 ... utilized jas-plakinolide, a compound that induces actin polymeriza-tion by increasing actin nucleation and stabilizing actinfilaments and swinholide A, a drug that sequestersG-actin as dimers ... monomericG-actin i s a critical determinant for CTGF/CCN2 geneinduction. These data indicate that distinct cytoskeletallybased signaling events within the intracellular signalingmachinery a ect either...
- 15
- 576
- 0
Tài liệu Báo cáo khoa học: An alternative transcript from the death-associated protein kinase 1 locus encoding a small protein selectively mediates membrane blebbing pdf
... rectal carcinoma as compared to normal colonic tissue. Colon carcinoma cells, rectal carcinoma cells and their normal healthytissue counterparts were harvested ( 1a, carcinoma cells; 4a, normal ... protein kinase 1 (DAPK-1) is a Ca2+⁄ calmodulin-regulated serine ⁄ threonine kinasecomposed of multiple functional domains, including a kinase domain, a calmodulin-binding domain, eightankyrin ... occur in human cancers.To begin functional studies of s-DAPK-1, the s-DAPK-1 cDNA was cloned into a Flag–Myc vector(Fig. 2A) , which contains an N-terminal Flag tag and a C-terminal Myc tag, and...
- 11
- 659
- 0
Báo cáo khoa học: "Acquiring a Lexicon from Unsegmented Speech" potx
... and assume that learning takes place in an environment where simple semantic representations of the speech intent are available to the acquisition mechanism. For example, we approximate the ... the greater problem as that of learning from inputs like Phon. Input: /~raebltslne~ b~W t/ Sem. Input: { BOAT A IN RABBIT THE BE } (The rabbit's in a boat.) where the semantic input ... with an empty dictionary, early in the acquisition process, and receives the simple utterance/nina/{ NINA } (a child's name). Naturally, it is unable to parse the input. Utterance:...
- 3
- 315
- 0
Báo cáo khoa học: Novel a-conotoxins from Conus spurius and the a-conotoxin EI share high-affinity potentiation and low-affinity inhibition of nicotinic acetylcholine receptors doc
... the A super-family, containing a- conotoxins, aA-conotoxins and jA-conotoxins [1].Competitive antagonists of the nicotinic acetylcholinereceptors (nAChRs) belong to the a and aA families.On the ... r-conotoxins and aS-conotoxins; the T superfamily, containinge-conotoxins and v-conotoxins; the P superfamily,containing the spasmodic peptides; the I superfamily,containing several jI-conotoxins, and the ... RNaseinhibitor, and 20 units of AMV reverse transcriptase. The reaction was incubated at 25 °C for 10 min, and then at42 °C for 60 min. The reverse transcriptase was inactivatedby incubation...
- 14
- 532
- 0
Báo cáo khoa học: AtCYS1, a cystatin from Arabidopsis thaliana, suppresses hypersensitive cell death ppt
... second hairpin loop and the papainregion including Trp177. In addition, in the papain–AtCYS1 complex the inhibitor Arg12 residue faces papainLys156, resulting in an unfavourable electrostatic inter-action ... amplificationof the AtCYS1 cDNA using specific primers carrying a BamHI site (forward:GGATCCGCGGATCAACAAGCAGGAACA) and a SalI site (reverse:GTCGACTCACGTGGTCTGAGAGCACAC) for directional cloning(restriction ... observed in the modelled complex between inhibitor Asp15 and Asp18, and papain Lys139 and Lys156. In the papain–AtCYS1 and papain–oryzacystatin-I complexes, steric hindrance isobserved between the...
- 12
- 240
- 0
Báo cáo khoa học: "Extracting a Representation from Text for Semantic Analysis" doc
... facet. Finally, we train a machine learning classi-fier on training data and use it to classify unseen test examples, assigning a Table 1 label for each reference answer facet. We used a variety ... be at a level that fa-cilitates detailed assessment of the learner’s under-standing, indicating exactly where and in what manner the answer did not meet expectations and 2) the representation ... representation and assessment should be learnable by an automated system – they should not require the handcrafting of domain-specific representations of any kind. Rather than have a single expressed...
- 4
- 265
- 0
Tài liệu Báo cáo khoa học: Fatty acid desaturases from the microalga Thalassiosira pseudonana pptx
... and elongations of the fatty acyl chain to generateEPA and DHA from a- linolenic acid (18:3D9,12,15).Besides the main routes leading to DHA via D6-desatu-ration, some algae display an alternate ... oils and fatty acids, in particular the useof algal oils containing long chain polyunsaturatedfatty acids (LCPUFAs). The most prominent of theseare the health beneficial omega-3 eicosapentaenoic ... produce and accumulate EPA and DHA in triacylglycerols (TAGs) [3]. For biotechno-logical applications, these organisms are regarded asKeywordsdesaturases; long chain polyunsaturatedfatty acids;...
- 12
- 618
- 0
Báo cáo khoa học: Small peptides derived from the Lys active fragment of the mung bean trypsin inhibitor are fully active against trypsin pptx
... be reached, and the BApNA was thenadded. The residual trypsin activity was measured at410 nm with a U-2800 spectrophotometer (Hitachi, Tokyo,Japan). The assay for chymotrypsin inhibitory activity ... (GeneBankaccession number AY713305) by using 3¢-RACE and 5¢-RACE (Fig. 1). The 591 bp full-length cDNAincludes a 3¢-UTR and two polyA signals (AATAAA)located upstream of the polyA tail. The ... lgÆmL)1trypsin and variousamounts of the sample, using BApNA (500 lm) as a sub-strate. All assays were carried out at 25 °C. The enzymewas first incubated with the inhibitor for 5 min to allowequilibrium...
- 9
- 409
- 0
Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Báo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP