0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: A profile of the residues in the second extracellular loop that are critical for ligand recognition of human prostacyclin receptor pdf

Báo cáo khoa học: A profile of the residues in the second extracellular loop that are critical for ligand recognition of human prostacyclin receptor pdf

Báo cáo khoa học: A profile of the residues in the second extracellular loop that are critical for ligand recognition of human prostacyclin receptor pdf

... 128–137 ª 2007 The Authors Journal compilation ª 2007 FEBS 137 A profile of the residues in the second extracellular loop that are critical for ligand recognition of human prostacyclin receptor Feng ... providefurther specific ligand- binding information. The ligand- binding data for some mutants, such as W17 6A andL172I, showed an increase that was clearly beyond the standard deviation. The substitutions ... furthermore indicates that the residues Fig. 7. The residues important for the ligand interaction in the eLP2 region of TP. The residues that lost binding activity in the mutagenesis studies are...
  • 10
  • 354
  • 0
Báo cáo khoa học: A novel serine protease highly expressed in the pancreas is expressed in various kinds of cancer cells potx

Báo cáo khoa học: A novel serine protease highly expressed in the pancreas is expressed in various kinds of cancer cells potx

... (forward, CCCAAGCTTACCATGAATCTACTCCTGAT; reverse, GTTGGTACCTTGTCATCATCATCAAAGG), and inserted into the pcDNA3 vector (Invitrogen) at the HindIII and KpnIsites to produce pTSd. The cDNA fragment ... reported that the alternative splicing of hippostasin is regulated in a cancer-specific manner [16]. In addition, serum levels of hippostasin are increased in patients with ovarianand prostate cancers ... prosemin was detected as a single band by silver staining (lane 2).(B) After activation by enterokinase, recombinant prosemin was incubated with Boc-Gln-Ala-Arg-MCA at 37 °C for the indicated...
  • 13
  • 483
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A Tradeoff between Compositionality and Complexity in the Semantics of Dimensional Adjectives" potx

... of relations that appear in the knowledge base. Thus in the present paper, I investigate the kinds of relations that appear in formal theories of the meanings of the following morphosyntactic ... unacceptable for an applica- tion if it is crucial that the inferred intervals con- tain precisely those values that are warranted by the constraints and the initial labelling. If a superset of ... plexity of the compositional approach may be manageable if certain assumptions about the application domain can be made. TOPIC AREAS: semantics, AI-methods in com- putational linguistics 1 Introduction...
  • 10
  • 537
  • 0
Báo cáo khoa học: Expression profile of PIN, AUX ⁄ LAX and PGP auxin transporter gene families in Sorghum bicolor under phytohormone and abiotic stress pot

Báo cáo khoa học: Expression profile of PIN, AUX ⁄ LAX and PGP auxin transporter gene families in Sorghum bicolor under phytohormone and abiotic stress pot

... PINtrafficking, and provides an additional mechanism for the fine regulation of auxin transport [26]. The para-logs of AUX1, LAX1, LAX2 and LAX3 maintainphyllotactic patterning, and buffer the PIN-mediatedpatterning ... Bootstrap values are presented for all branches. (A) PIN: data on AtPIN and OsPIN families (Tables S3and S4) is based on TAIR annotation and Wang et al. [18]. (B) LAX: Inventory of the AtLAX and ... establishment of embryonic root cell organization in Arabidopsis tha-liana [30]. In addition, AUX1 and LAX3 are involved in auxin–ethylene interactions during apical hookdevelopment in Arabidopsis seedlings...
  • 16
  • 417
  • 0
Báo cáo khoa học: A sucrose binding protein homologue from soybean exhibits GTP-binding activity that functions independently of sucrose transport activity pptx

Báo cáo khoa học: A sucrose binding protein homologue from soybean exhibits GTP-binding activity that functions independently of sucrose transport activity pptx

... increase the totalprotein extract as starting material in the binding reactionled to a remarkable increase in the background levelscompromising the quality and interpretation of the data. The ... for the wild-type protein (comparelanes 1 and 3). The presence of high molecular massmigrating forms of the mutated protein in the absence of 2-mercaptoethanol indicated that mutation in the ... that these residues are critical for binding.Although there was some variation on protein amount, the mutant recombinant protein and the fusion-truncatedprotein accumulated to similar levels in...
  • 11
  • 343
  • 0
Báo cáo khoa học: A novel, promoter-based, target-specific assay identifies 2-deoxy-D-glucose as an inhibitor of globotriaosylceramide biosynthesis docx

Báo cáo khoa học: A novel, promoter-based, target-specific assay identifies 2-deoxy-D-glucose as an inhibitor of globotriaosylceramide biosynthesis docx

... B4GalT6, GM3Sand GAPDH cDNA, the following primers were used: for B4GalT6, the forward primer 5¢-TGAACAGACTGGCACACAACC-3¢ and the reverse primer 5¢-TGTCAGCCCACTTACACCAC-3¢; for GM3S, the forward ... forward primer 5¢-CGTCCCCACAATCGGTGTCA-3¢ and the reverse primer5¢-ACCACTCCCTCTTTGACCAG-3¢; for GAPDH, the forward primer 5¢-CCACCCATGGCAAATTCCATGGCA-3¢ and the reverse primer 5¢-TCTAGACGGCAGGTCAGGTCCACC-3¢. ... synthase gene; Gb4, globotetraosylceramide (GalNAcb1,3Gala1,4LacCer); GD 1a, NeuAca2,3Galb1,3GalNAcb1,4(NeuAca2,3)LacCer; GD1b, Galb1,3GalNAcb1,4(NeuAca2,8NeuAca2,3)LacCer; GM1, Galb1,3GalNAcb1,4(NeuAca2,3)LacCer;...
  • 12
  • 303
  • 0
Báo cáo khoa học: Myocyte enhancer factor 2B is involved in the inducible expression of NOX1⁄ NADPH oxidase, a vascular superoxide-producing enzyme ppt

Báo cáo khoa học: Myocyte enhancer factor 2B is involved in the inducible expression of NOX1⁄ NADPH oxidase, a vascular superoxide-producing enzyme ppt

... mitochon-drial respiratory chain. Biochem J 386, 255–261.9 Fan C, Katsuyama M, Nishinaka T & Yabe-Nishimura C(2005) Transactivation of the EGF receptor and a PI3kinase-ATF-1 pathway is involved in ... Katsuyama M, Fan C, Arakawa N, Nishinaka T, Miy-agishi M, Taira K & Yabe-Nishimura C (2005) Essen-tial role of ATF-1 in induction of NOX1, a catalyticsubunit of NADPH oxidase: involvement of mitochon-drial ... mRNA. Accordingly, the 5¢-flanking region of exon 1c appears to contain ele-ments essential for the specific expression of the NOX1mRNA in dedifferentiated VSMC. In the aorta or in a vascular...
  • 9
  • 452
  • 0
Báo cáo khoa học: A Kazal prolyl endopeptidase inhibitor isolated from the skin of Phyllomedusa sauvagii pdf

Báo cáo khoa học: A Kazal prolyl endopeptidase inhibitor isolated from the skin of Phyllomedusa sauvagii pdf

... direct interaction with theirmembranes.Materials and methodsMaterialsAll chemicals were of the purest analytical grade available.Proteases, aprotinin, lysozyme, and a- casein were fromSigma-Aldrich. ... and to other extracellular matrix proteins that are not protease inhibitors but containKazal-like motifs. The closest relatives of PSKP-1 are serineprotease inhibitors, and a few examples are ... heparin.Certain basic proteins have ancillary antibacterial activ-ity. Some examples are aprotinin, SLPI, and CAP18 [39,40].All seem to interact with bacterial membranes, although the molecular basis of...
  • 10
  • 456
  • 0
Tài liệu Báo cáo khoa học: An immunomodulator used to protect young in the pouch of the Tammar wallaby, Macropus eugenii pptx

Tài liệu Báo cáo khoa học: An immunomodulator used to protect young in the pouch of the Tammar wallaby, Macropus eugenii pptx

... Committee.Acetylcholine, atropine, concanavalin A, CCK-8 andCCK-8-NS were obtained from Sigma-Aldrich. Alamar bluewas obtained from Astral Scientific (Caringbar, New SouthWales, Australia).Guinea pigs weighing approximately ... Bioscience, The University of Queensland, Brisbane, Queensland, AustraliaMarsupials are born in an immature state and many of the developmental processes that occur in thesemammals take place during ... cleavages) are fragmentations of amide moieties, and give infor-mation analogous to that provided by B and Y+2cleavages in the corresponding positive ion spectra. The other backbone cleavages...
  • 11
  • 638
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Using adaptor grammars to identify synergies in the unsupervised acquisition of linguistic structure" docx

... which the subtrees are specified in advance, in an adaptor grammar the subtrees, aswell as their probabilities, are learnt from the train-ing data. In order to make parsing and inferencetractable ... repeatedly drawing a ball at random from the urn and then returning itplus an additional ball of the same color to the urn. In an adaptor grammar there is one DP for eachadapted nonterminal A ... seeJohnson et al. (2007b). Formally, an adaptor gram-mar is a PCFG in which a subset M of the nonter-minals are adapted. An adaptor grammar generates the same set of trees as the CFG with the same rules,but...
  • 9
  • 643
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họccách làm báo cáo khoa họctrình bày báo cáo khoa họcBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngChuong 2 nhận dạng rui roBT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ