Báo cáo khoa học: " Focusing on focus: a formalization" pptx

... what can be 2 Again here we are aware of the argument that activation is a continous rather than a discrete concept. Due to space limit we only discuss a few major points here; for an elaborate ... state of DM in relation to KS sAz ~/AZ Figure 2" ;On- line' state of DM in relation to KS; AZ, SAZ & IAZ IAZ Figure 2 deserves more explanation as the on- line state of and ... Moreover, a card has one and only one referent but may have none, one or more attributes and links. Borrowing the notion of activation from Chafe (1987), we distinguish three zones, i.e., activated...

Báo cáo khoa học: "Focusing on Scenario Recognition in Information Extraction" pot

... ballacross the penalty area to AlanShearer who heads into the back ofthe net at the far post and scores.Logical form: score( A) &theta( A, agnt,'Alan Shearer') &head( C) & ... way, way, over.Logical Form:not (be( A) &theta( A fagnt,'Jaap Stem') &theta( A, char, B) & next( B) &score( C)& theta( C,agnt,'JaapStam')) & time ... effects;-preconditions-causality: an action A mayhave preconditions B1, B2, , B.;-enablement - action A enables action B;-decomposition - action A is performed whensubactions B1, B29...

Báo cáo khoa học: "Investigations on Event-Based Summarization" pptx

... and event elements it contains. 5 Evaluation 5.1 Dataset and Evaluation Metrics DUC 2001 dataset is employed to evaluate our summarization approaches. It contains 30 clus-ters and a total ... triples. After analysis of triples they connect nodes (words or phrases) by way of se-mantic relationships. Yoshioka and Haraguchi (2004) adopt a similar approach to build a map, but they regard ... summarization. Manual summaries with 50 words, 100 words, 200 words and 400 words are provided. Since manual evaluation is time-consuming and may be subjective, the typical evaluation package,...

Báo cáo khoa học: "Interlingua and MT, a Discussion" pptx

... There is also in many cases a confusion between a spatial and a temporal sense, as in 'ante,' which as a preposition can mean either 'in front of (in space) or 'before' ... either an adverb or a pronoun 'que' may be either a conjunction, an interrogative pronoun, or a relative pronoun; 'bastante' may be either an adjective or an adverb; and so ... an adverb or a conjunction; 'omne' may be either an adjective or a pronoun; 'ancora' may be either an adverb or an inter jection; 'alique' may be either an...

Báo cáo khoa học: "Restrictions on Tree Adjoining Languages" pptx

... Restrictions on Tree Adjoining Languages Giorgio Satta Dip. di Elettronica e Informatica Universit£ di Padova 35131 Padova, Italy satta@dei, unipd, it William Schuler Computer and Information ... grammar, and Schabes and Waters forbid wrap- ping auxiliaries altogether, at any node in the grammar. We now focus on the recognition problem, and informally discuss the computational ad- ... are meant to exhaustively characterize the auxiliary trees used in any natural language TAG grammar. 2 An athematic auxiliary tree does not subcategorize for or assign a thematic role to...

Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

... CACCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA NcoIW168F WT W168F GAACCTTTATTCGCTATTGGTACCGGTAAA KpnIWT* W11F W11F ⁄ W168F GAACCTTTATTCGCTATTGGTACCGGTAAA KpnIY74W* WT* W11F ⁄ W168F ⁄ Y74W TCACCGGTCCATGATCCATT ... mutationsMousumi Banerjee1, Hemalatha Balaram2and Padmanabhan Balaram11 Molecular Biophysics Unit, Indian Institute of Science, Bangalore, India2 Molecular Biology and Genetics Unit, Jawaharlal ... Ravindra G & Balaram P (2005) Plasmodiumfalciparum triosephosphate isomerase: new insights intoan old enzyme. Pure Appl Chem 77, 281–289.20 Parthasarathy S, Ravindra G, Balaram H, Balaram...

Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc

... Preparation ofmitochondria from animal tissues and yeasts. In Subcellularcomponents. Preparation and Fractionation (Birnie, G.D., ed.), pp.77–91. Butterworths, London.38. Gornall, A. G., Bardawill, ... membrane potential; mitochondria; mitochond-rial DNA; targeting.Mammalian mitochondrial DNA (mtDNA) encodes 13polypeptides and the RNA machinery for their transcrip-tion and translation [1–3]. ... (Fig. 4A, B). Extensive alkylation of the DNA wasnoted after 1 h incubation at concentrations as low as50 lMmitoDC-81 (Fig. 4A, B). That the concentration ofmtDNA within mitochondria is also...

Báo cáo khoa học: Studies on structure–function relationships of indolepyruvate decarboxylase from Enterobacter cloacae, a key enzyme of the indole acetic acid pathway ppt

... molecular mass standards.Small angle X-ray solution scattering with synchrotronradiation. Data were collected on the X33 camera of theEuropean Molecular Biology Laboratory outstation atHasylab at ... detail, a coupled opticalassay was elaborated with alcohol dehydrogenase asauxiliary enzyme, catalysing the aldehyde–alcohol conver-sion similar to the assays established for pyruvate decarb-oxylase ... benzoylformic acid, and seven benzoyl-formic acid analogues was investigated using a continuousoptical assay. Stopped-ﬂow kinetic data showed no indica-tion for substrate activation in the decarboxylation...

Báo cáo khoa học: What’s in a covalent bond? On the role and formation of covalently bound flavin cofactors doc

... –L-Gulono-c-lactone oxidase [145] N1Animal VAO –L-Gluconolactone oxidase [146] N3Fungus VAO –L-Galactonolactone oxidase [147] N1Yeast VAO –D-Arabinono-1,4-lactone oxidase [148] Yeast VAO –Sorbitol ... This artiﬁ-cial covalent ﬂavinylation (again, FAD is linked via an8-carbon rather than 8a- carbon linkage) resulted in anincreased kcatvalue with d-alanine from 1.5 s)1for themutant enzyme, ... (1994) Characterisation of d-arabinono-14-lactone oxidase from Candida albicans ATCC 10231.Eur J Biochem 225, 1073–1079.149 Hiraga K, Kitazawa M, Kaneko N & Oda K (1997)Isolation and some...

Báo cáo khoa học: Tumour necrosis factor-a attenuates insulin action on phosphoenolpyruvate carboxykinase gene expression and gluconeogenesis by altering the cellular localization of Foxa2 in HepG2 cells pptx

... protein assaykit (Biorad Laboratories).Densitometric analysisEach band, when mentioned, was analysed by alpha digi-doc 1201 software (Alpha Innotech Corporation, SanLeandro, CA, USA). The same ... on phosphoenolpyruvate carboxykinase gene expression andgluconeogenesis by altering the cellular localization ofFoxa2 in HepG2 cellsAmit K. Pandey, Vikash Bhardwaj* and Malabika DattaInstitute of Genomics and ... triplicate and the dataare presented as the mean ± standard error of the mean(SEM). Student’s t-test was used for statistical analysis andP < 0.05 was taken to be statistically signiﬁcant.AcknowledgementsThis...

Xem thêm

Từ khóa: báo cáo khoa học mẫu báo cáo khoa học y học báo cáo khoa học sinh học báo cáo khoa học nông nghiệp báo cáo khoa học lâm nghiệp báo cáo khoa học thủy sản Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018 Một số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTP đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khí Chuong 2 nhận dạng rui ro Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI