0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: "Contents and evaluation of the first Slovenian-German online dictionary" doc

Báo cáo khoa học:

Báo cáo khoa học: "Contents and evaluation of the first Slovenian-German online dictionary" doc

... equivalent in the other language, as many entries as necessary arecreated.3 Evaluation The evaluations of the Slovenian part of the dic-tionary concern its coverage of a) the corpus of the Slovenian ... under-stand of the lexical content of the newspaper text.In the case of non-related lemmas, one of themis usually much more frequent (as with avto and avt), whereas in the case of related ... Slovenian, the text is spell-checked and proof-read, the error-rateis low (Jakopin, 2002). The results of our evalu-ation will give an approximation of how well the lexical knowledge represented in the...
  • 4
  • 321
  • 0
Báo cáo khoa học: Structure and activity of the atypical serine kinase Rio1 doc

Báo cáo khoa học: Structure and activity of the atypical serine kinase Rio1 doc

... nucleotidebinding. These include the YL and RF motifs from the flexible loop (Fig. 1D), the Trp116, Lys119,Arg122 and Asn123 from aC, Gln215 of the catalyticloop and the HP motif between b10 and aF. All theseresidues, ... between Rio2 and the beginning of the flexible loop. The difference in the length of the hingeregion between Rio1 and Rio2 is due to an insertion of a b-hairpin in Rio1 that closes off the active ... with the uncomplexed protein. Com-parisons of the structure of Rio1 with the previously determined structure of the Rio2 kinase defined the minimal RIO domain and the distinct fea-tures of the...
  • 16
  • 315
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Development and Evaluation of a Broad-Coverage Probabilistic Grammar of English-Language Computer Manuals" pdf

... labels and parts -of- speech of the treebank parse. The second candidate parse is incorrect, since two of its part -of- speech labels and one of its bracket labels differ from those of the treebank ... parse is, then, the follow- ing. Given a pair of nonterminals B and C in the CKY chart, if the span of the parent is not structure-consistent then this occurence of B C cannot be used in the parse ... similar task and reported 30% of input sentences as having been correctly parsed. On the basis of the pre- ceeding evidence it seems that the current state of the t At least one of the parties...
  • 8
  • 562
  • 0
Tài liệu Báo cáo khoa học: Investigation and prediction of the severity of p53 mutants using parameters from structural calculations pptx

Tài liệu Báo cáo khoa học: Investigation and prediction of the severity of p53 mutants using parameters from structural calculations pptx

... advantage of p53 mutation analysis, and a unique feature of this database, is the availabil-ity of the residual activity of the majority of p53 mis-sense mutants. The biological activity of mutant ... prediction of the severity of p53 mutants. The method was trained on a set of known mutants and subsequently evaluated on anotherset. The method is based on parameters reflecting the bio-chemical and ... powerful method, and several algorithms have been developed recently [4–7]. The major drawback of these analyses is the lack of information regarding the activity or loss of activity of the target...
  • 14
  • 561
  • 0
Báo cáo khoa học: Structure and mechanism of the ThDP-dependent benzaldehyde lyase from Pseudomonas fluorescens potx

Báo cáo khoa học: Structure and mechanism of the ThDP-dependent benzaldehyde lyase from Pseudomonas fluorescens potx

... with the gene of the benzaldehyde lyase and for helpful discus-sions, the teams of the Swiss Light Source (Villigen ⁄ CH) and of the EMBL outstation Hamburg for their helpwith data collection and ... important for cofactor binding and catalysis. The BAL residues are labeled and the BAL hydrogenbonds are displayed. The yellow and red residues at the top are His70 of BFD and Asn28 of PDC, respectively. ... consist of a cen-tral six-stranded parallel b-sheet flanked by a varyingnumber of a-helices. Residues involved in binding of the cofactor ThDP are located at the C-terminal ends of the b-strands of...
  • 10
  • 454
  • 0
Báo cáo khoa học: Cloning and characterization of the genes encoding toxic lectins in mistletoe (Viscum album L) pot

Báo cáo khoa học: Cloning and characterization of the genes encoding toxic lectins in mistletoe (Viscum album L) pot

... intensity of the bandsmay be the result of a different copy number of the genes in the hybridizing fragments. If so, the number of the bands donot represent the family size. Thus, the mlp gene ... Leu117)or Met (Met153 of the ML1p and ML2p B-chains and Met156 of the ML3p B-chain corresponding to the ricinB-chain Leu152; and Met234 of the ML1p and ML2pB-chains corresponding to the ricin B-chain ... quantitativeratio of the amplification products of the three gene variantsin the amplified fragment was assessed by calculation of the ratio of radioactivity of the corresponding bands.Quantitative PCRThe...
  • 11
  • 610
  • 0
Báo cáo khoa học: Expression and characterization of the protein Rv1399c from Mycobacterium tuberculosis A novel carboxyl esterase structurally related to the HSL family docx

Báo cáo khoa học: Expression and characterization of the protein Rv1399c from Mycobacterium tuberculosis A novel carboxyl esterase structurally related to the HSL family docx

... experimentally. Indeed, the presence of Arg213 along with the proximity of the chargerelay Asp260 within the active site could be responsible for the modification of the catalytic properties of the catalytichistidine. ... avor the displacement of the equilibriumtoward the neutral state of His290.To attest this hypothesis, an Arg213Ala mutant has beenexpressed and characterized. The specific activity of the Ala213 ... [23].Results and DiscussionCloning and expression of Rv1399c The Rv1399c gene product encodes a 318 amino acidprotein with a molecular mass of  31.7 kDa and acalculated pI of 4.53 and belongs to the...
  • 9
  • 584
  • 0
Báo cáo khoa học: Cloning and expression of the first nonmammalian interleukin-11 gene in rainbow trout Oncorhynchus mykiss pdf

Báo cáo khoa học: Cloning and expression of the first nonmammalian interleukin-11 gene in rainbow trout Oncorhynchus mykiss pdf

... were present in the 3¢-UTR as well as in the 5¢-UTR, and four potentialpoly(A) signals were found in the 3¢-UTR (Fig. 1), two of them just 14 or 23 bp upstream of the poly(A) tail. The remaining ... organizationresembles that of mammalian IL-11. The sequencesbetween the trout cDNA and genomic DNA in the coding region are identical, although there were differ-ences in both the 5¢- and 3¢-UTR. The major ... differ-ences were a 26 bp insertion in the 5¢-UTR of the cDNA and an insertion of 12 repeats with a consensus of CCAATGATGATCCAAGAAATCCACACTACAG(31 bp) in the 3¢-UTR of the cDNA sequence (Fig. 1).A...
  • 12
  • 511
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Analysis and Synthesis of the Distribution of Consonants over Languages: A Complex Network Approach" pptx

... these 21 consonants.On the other hand Regime 2 of Figure 3(a) as wellas Regime 1 of Figure 3(b) comprises of the rest of the consonants. The point marked as x in both the figures indicates the ... correspondingto the nodes in the set VL and the other corre-sponding to the nodes in the set VC.Degree distribution of the nodes in VL: Fig-ure 2 shows the degree distribution of the nodesin ... VLwhere the x-axis denotes the degree of eachnode expressed as a fraction of the maximum de-gree and the y-axis denotes the number of nodeshaving a given degree expressed as a fraction of the...
  • 8
  • 550
  • 0
Báo cáo khoa học: Structure and topology of the transmembrane domain 4 of the divalent metal transporter in membrane-mimetic environments docx

Báo cáo khoa học: Structure and topology of the transmembrane domain 4 of the divalent metal transporter in membrane-mimetic environments docx

... in the presence of Gd3+at pH 4.0, but the degree to which the intensities recovered was lower in the presence of Gd3+,particularly for the C-terminal residues, than in the presence of the ... suggeststhat the C-terminus of the peptide is partially embedded intoSDS micelles at pH 4.0, which may therefore block the entrance of either solvent molecules or metal ions. The movement of the C-terminus ... toexplore the molecular biology aspects of DMT1 since the discovery of this gene, there has so far been no structuralcharacterization of either this integral protein or a segment of it. Analysis of the...
  • 14
  • 486
  • 0

Xem thêm

Từ khóa: chuyên đề điện xoay chiều theo dạngMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ