0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: Cofactor-independent oxygenation reactions catalyzed by soluble methane monooxygenase at the surface of a modified gold electrode pot

Báo cáo khoa học: Cofactor-independent oxygenation reactions catalyzed by soluble methane monooxygenase at the surface of a modified gold electrode pot

Báo cáo khoa học: Cofactor-independent oxygenation reactions catalyzed by soluble methane monooxygenase at the surface of a modified gold electrode pot

... Cofactor-independent oxygenation reactions catalyzed by soluble methane monooxygenase at the surface of a modified gold electrode Yann Astier1*, Suki Balendra2, H. Allen O. Hill1, Thomas ... electrochemical oxygenation; regulatory protein; soluble methane monooxygenase. Soluble methane monooxygenase (sMMO) catalyses the bacterial oxidation of methane to methanol usingNAD(P)H as cofactor ... electrodes was ventilated by means of a stream of air from an electric fan. The effect of the substrate methane on the electrochemical properties of the MMOH/MMOB/catalase system was investigated by enclosing...
  • 6
  • 464
  • 0
Tài liệu Báo cáo khoa học: Efficient RNA ligation by reverse-joined hairpin ribozymes and engineering of twin ribozymes consisting of conventional and reverse-joined hairpin ribozyme units ppt

Tài liệu Báo cáo khoa học: Efficient RNA ligation by reverse-joined hairpin ribozymes and engineering of twin ribozymes consisting of conventional and reverse-joined hairpin ribozyme units ppt

... proceeds withsimilar activity at both individual sites; cleavage ratesare virtually identical, ligation rate constants vary by a factor of only about 2.5.Alteration of RNA sequence by the twin ribozymeHP–TWRJ The ... Secondary structures of ribozyme substrate complexes used for measuring cleavage (A) or ligation (B) rates at either site. Cleavageand ligation at the second site was abolished by replacing the ... cleavage of the substrate fol-lowed by dissociation of the 16-mer versus favourableligation of the 20-mer. The yield of product RNA P44F3F5 could be fur-ther increased by stabilization of the...
  • 11
  • 481
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Parsing with Treebank Grammars: Empirical Bounds, Theoretical Models, and the Structure of the Penn Treebank" ppt

... signature , let be the number of ac-tive states in the grammar which have that signature.Now, take a state of signature and a span .If we align the tags in with words in and align the categories ... was relativelyclose to its bound , active saturation is much fartherbelow . Furthermore, while passive saturation wasrelatively constant in span size, at least after a point,active saturation ... estimate the total passive edge counts by sum-mation:10 The maximum possible passive saturation for any spangreater than one is equal to the number of phrasal categoriesin the treebank grammar:...
  • 8
  • 404
  • 0
Báo cáo khoa học: Human ATP-dependent RNA ⁄ DNA helicase hSuv3p interacts with the cofactor of survivin HBXIP ppt

Báo cáo khoa học: Human ATP-dependent RNA ⁄ DNA helicase hSuv3p interacts with the cofactor of survivin HBXIP ppt

... reverseprimers: CCATCCATGGCTAGGAAGCAAGGGACAGCTCTCC, GGATCCATGGTCATGGAAACATATCCATAAATCGG and CCATCCATGGTCAGTTGATAGGAGCTGTGAAGAAAAC, respectively (all incorporating NcoIsite, underlined). The resulting ... PCR amplification of the appropriate hSuv3p cDNA fragments using the followingforward primer CCTGAATTCGATGCCAGCCTTATTCGAGATCTCC (EcoRI site underlined) and the reverse prim-ers as in the case ... GCGGAATTCTCTGTGAGTCGGCAGATTGAA (forward; incorporating EcoRI site, under-lined) and CATGCCATGGCTAGTCCGAATCAGGTTCCT (reverse, incorporating NcoI site, underlined). The resulting fragment was...
  • 12
  • 468
  • 0
Báo cáo khoa học: Affinity purification-mass spectrometry Powerful tools for the characterization of protein complexes ppt

Báo cáo khoa học: Affinity purification-mass spectrometry Powerful tools for the characterization of protein complexes ppt

... molecules. Thesecollisions result in cleavage of the peptide along the peptidebackbone and creates a set of fragments that differ in length by one amino acid each. The masses of the fragments canagain ... sequencing by Edman degradation. Todate, hundreds to several thousands of proteins may beFig. 1. Schematic representation of the tandem a nity purification method. (A) Structure of the TAP-tag. (B) TAP ... detectionand sequencing in an MS experiment, notably the presence of a basic amino acid at the C-terminus of a peptide. Thereis a new trend that aims at avoiding protein separation by Table 2....
  • 9
  • 415
  • 0
Báo cáo khoa học: Light-induced reactions of Escherichia coli DNA photolyase monitored by Fourier transform infrared spectroscopy pot

Báo cáo khoa học: Light-induced reactions of Escherichia coli DNA photolyase monitored by Fourier transform infrared spectroscopy pot

... titration of the irradiated DNA showed that about 50% of the bases had been converted to dimers (data not shown).Samples containing a mixture of photodamaged DNAand blue radical enzyme at an approximate ... (data not shown)] whichappears as a valid model for the study of the DNAphotorepair process.Photoactivation of the catalytically blue radicalform of DNA photolyaseOverexpression strains of ... difference infrared spectra with a sig-nificantly modified pattern of absorption bands attrib-uted to the blue radical form (negative bands of traceB in Fig. 4) and to the catalytically active FADH)form...
  • 12
  • 393
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Predicting User Reactions to System Error" ppt

... ’ indicatesthat the featurevalue ofthe first cat-egory is either significantly higher or lower than the second. Note that, for each of the pairs, thereis at least one prosodic feature that distinguishes the ... classification. Of the features that appearin the ruleset, about half are features of currentturn and half features of the prior context. Onlyonce does a system featureappear, suggesting that the rules ... they ap-pear independent of system characteristics. Also, of the contextual features appearing in the rules,about half are prosodic features and half ASR-related; and, of the current turn features,...
  • 8
  • 215
  • 0
Tài liệu Báo cáo khoa học: An anthrax lethal factor mutant that is defective at causing pyroptosis retains proapoptotic activity pdf

Tài liệu Báo cáo khoa học: An anthrax lethal factor mutant that is defective at causing pyroptosis retains proapoptotic activity pdf

... An anthrax lethal factor mutant that is defective at causing pyroptosis retains proapoptotic activityStephanie Ngai, Sarah Batty, Kuo-Chieh Liao and Jeremy MogridgeDepartment of Laboratory ... inducing vascular leakage that leadsto shock and multiorgan failure [3–6]. The role of LeTx in anthrax pathogenesis is complex, however,and probably involves the impairment of the innateand adaptive ... of the ERK pathway. Ourresults suggest that LF-K518E ⁄ E682G is defective at cleaving a substrateinvolved in the activation of the Nlrp1b inflammasome.AbbreviationsERK, extracellular signal-related...
  • 9
  • 579
  • 0
Tài liệu Báo cáo khoa học: Accessibility changes within diphtheria toxin T domain when in the functional molten globule state, as determined using hydrogen⁄deuterium exchange measurements pdf

Tài liệu Báo cáo khoa học: Accessibility changes within diphtheria toxin T domain when in the functional molten globule state, as determined using hydrogen⁄deuterium exchange measurements pdf

... aggregate at high concen-trations, etc. In the case of the T domain, the MGstate corresponds to the functional state, which initi-ates the translocation of the catalytic domain. Here, the data allowed ... either acid -catalyzed orbase -catalyzed [20]. As a consequence, the dependence of Log(kexch) (the logarithm of the exchange rate) as a function of the pH is a chevron plot with a mini-mum of ... the clathrin-coated pathway. The acidic pH in the endo-some triggers a conformational change, leading toinsertion of the toxin in the membrane. The C domainis then translocated across the endosomal...
  • 10
  • 530
  • 0
Tài liệu Báo cáo khoa học: Collagen I regulates matrix metalloproteinase-2 activation in osteosarcoma cells independent of S100A4 pdf

Tài liệu Báo cáo khoa học: Collagen I regulates matrix metalloproteinase-2 activation in osteosarcoma cells independent of S100A4 pdf

... Gelatinase-mediatedmigration and invasion of cancer cells. Biochim BiophysActa 1755, 37–69.4 Chen JM, Fortunato M, Stevens RA & Barrett AJ(2001) Activation of progelatinase A by mammalianlegumain, ... Further, autoactivation of the active 62 kDa form to a C-terminally truncated45 kDa form was also inhibited by TIMP-1.Investigation of mechanisms that may explain the increased activation of ... & Murphy G(1996) The soluble catalytic domain of membrane type1 matrix metalloproteinase cleaves the propeptide of progelatinase A and initiates autoproteolytic activation.Regulation by...
  • 12
  • 572
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘITÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ