Báo cáo khoa học: Possible involvement of an FKBP family member protein from a psychrotrophic bacterium Shewanella sp SIB1 in cold-adaptation potx

Báo cáo khoa học: Possible involvement of an FKBP family member protein from a psychrotrophic bacterium Shewanella sp. SIB1 in cold-adaptation potx

... family member protein from a psychrotrophic bacterium Shewanella sp. SIB1 in cold-adaptation Yutaka Suzuki, Mitsuru Haruki*, Kazufumi Takano, Masaaki Morikawa and Shigenori KanayaDepartment of ... of Material and Life Science, Graduate School of Engineering, Osaka University, Japan A psychrotrophic bacterium Shewanella sp. strain SIB1 wasgrown at 4 and 20 °C, and total soluble proteins ... members of the FKBP family, and threemembers of the parvulin family. Saccharomyces cerevisiaecontains eight members of the cyclophilin family, fourmembers of the FKBP family, and one member of...

Báo cáo khoa học: " The Development of Lexical Resources for Information Extraction from Text Combining Word Net and Dewey Decimal Classification" potx

... necessary lexicon for an average application is generally large (hundreds to thousands of words) and most lexical information is not transportable across domains. The problem of lexicon transport ... the FL. In general the quantity of application specific information is small. Any machine readable dictionary can be to some ex- tent seen as a BL. The transport of BL to new applications ... each entry in the FL can be very high and it is not transportable across domains and 225 Proceedings of EACL '99 applications, as it contains the mapping between the entries and the ontology....

Tài liệu Báo cáo khoa học: Crystal structure of an ascomycete fungal laccase from Thielavia arenaria – common structural features of asco-laccases ppt

... MaL,Melanocarpus albomyces laccase; PDB, Protein Data Bank; RlL, Rigidoporus lignosus laccase; rMaL, recombinant Melanocarpus albomyceslaccase; TaLcc1, Thielavia arenaria laccase; ThL, Trametes ... asco-laccases at high protein concentrations.DatabaseStructural data are available in the Protein Data Bank database under the accession numbers3PPS and 2VDZStructured digital abstractllaccase ... favourable region of the Ra-machandran plot (Table 2).Kinetic dataKinetic constants (Kmand Vmax) for rMaL, TaLcc1 andThL were determined on 2,6-DMP, syringic acid, andmethyl syringate, at...

Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt

... metal–ligand distances (Table 2) compare veryfavorably with data in the protein database, from which an average distance of 2.03 A ˚for Fe–N(His)was inferred [38], and a target distance of ... Meyer-Klaucke for data collection and assis-tance in data evaluation. The assistance of T. Pavkov(Institute of Chemistry, University of Graz) in theacquisition of CD and DLS data is gratefully acknowl-edged. ... sequences of Dke1 and a structurally characterized cupin protein from Rubrivivax gelatinosus PM1 (Protein Data Bankidentiﬁer: 2O1Q) that has been functionally annotatedas acetyl ⁄ propionyl-CoA carboxylase...

Tài liệu Báo cáo khoa học: Complete reconstitution of an ATP-binding cassette transporter LolCDE complex from separately isolated subunits docx

... PCR using a pair of oligonu-cleotides, 5¢-GAGCTCGAAGGAGATATAAATATGAATAAGATCCTGTTGCAATGC-3¢ and 5¢-AAGCCTGCAGTTTTTGTTCCACCAATATCAAACCC-3¢. The ampliﬁedDNA was digested with SacI and PstI, and ... C-terminus, PCR was performedwith pJY310 as a template and a pair of oligonucleotides,5¢-GATGAATTCGGAGGTTTAAATTTATGGCGATGCCTTTATCGTTATTAA-3¢ and 5¢-CAATTCAAGCTTAATGATGATGATGATGATGCTCCAGCTGGCCGCTAAGGACTCGCGCAG-3¢. ... oligonucleotides,5¢-GATGAATTCGGAGGTTTAAATTTATGTACCAACCTGTCGCTCTATTTA-3¢ and 5¢-CAATTCAAGCTTAATGATGATGATGATGATGCTCCAGTTCATAACGTAAAGCCTCAGCGG-3¢. The ampliﬁed DNA was digestedwith Eco RI and HindIII, and then cloned into the same site of pMAN885EH.To...

Báo cáo khoa học: The involvement of human ribonucleases H1 and H2 in the variation of response of cells to antisense phosphorothioate oligonucleotides pot

... Y. & Bambara, R .A. (1994) Enzymatic completion of mammalian lagging-strand DNAreplication. Proc. Natl Acad. Sci. USA 91, 9803±9807.25. Kurosawa,Y.,Ogawa,T.,Hirose,S.,Okazaki,T.&Okazaki,R.(1975) ... cancer), MiaPacaII (pancreatic carcinoma), T24(bladder carcinoma), HeLa (cervical carcinoma) andHTB82 (rhabdomyosarcoma), were obtained from theAmerican Type Culture Collection, or were gifts from colleagues. ... oligonucleotidesAnneloor L. M. A. ten Asbroek, Marjon van Groenigen, Marleen Nooij and Frank BaasNeurozintuigen Laboratory, Academic Medical Center, Amsterdam, the NetherlandsWe have analyzed the response...

Báo cáo khoa học: Structural recognition of an optimized substrate for the ephrin family of receptor tyrosine kinases pot

... target for thera-peutics aimed at cancer and leukemia. EPHA3 isinvolved in neural and retinal development in mam-mals, and was originally described as a determinant of Keywordsephrin kinase; ... [12–14], and in glioblastoma, melanomaand rhabdomyosarcoma cell lines, among others[15,16], suggesting that the EphA3 kinase domain is an attractive candidate for drug development in thesehighly aggressive ... overexpressed in invasive cancers, including breast, small-cell lung and gastrointestinal can-cers. However, little is known about direct substrates of EphA3 kinase andno chemical probes are available....

Báo cáo khoa học: "The Parameters of an Operational Machine Translation System" doc

... human translation for that matter, is the effective transference of meaning from one language to another. To satisfy ourselves that this transference of meaning was in fact taking place, an ... to warrant operational machine translation production from Russian- language materials, I do not wish to suggest that all problems in the transference of meaning from one language to another ... system; of translation, and of out- put are interpreted in terms of an operational machine translation center. The use of machines to do high-volume, high-speed translation from one natural language...

Báo cáo khoa học: Identiﬁcation of an osteopontin-like protein in ﬁsh associated with mineral formation pot

... 3¢)SaOP1-F01 CGCTCCAGCCGCTGAACTCCTGAAGCSaOP2-F02 CCACCCCTCAGCCCATCGACCCTACCSaOP3-F03 GGCGGGACCTGACACCACCACTGACASaOP2-R04 GGTAGGGTCGATGGGCTGAGGGGTGGSaOPreal-FW AAAACCCAGGAGATAAACTCAAGACAACCCASaOPreal-RV ... AAAACCCAGGAGATAAACTCAAGACAACCCASaOPreal-RV AGAACCGTGGCAAAGAGCAGAACGAASaRPL2 7a- FW AAGAGGAACACAACTCACTGCCCCACSaRPL2 7a- RV GCTTGCCTTTGCCCAGAACTTTGTAGFig. 1. SaOP-L full-length cDNA. (A) cDNA fragments obtained from the ... starting from thetranslation initiation codon and ending at the translation terminationcodon. The phase of intron insertion is indicated in 33black trianglesand is deﬁned according to Patthy...

Báo cáo khoa học: Differential involvement of protein kinase C alpha and epsilon in the regulated secretion of soluble amyloid precursor protein docx

... Differential involvement of protein kinase C alpha and epsilon in the regulated secretion of soluble amyloid precursor protein Cristina Lanni, Michela Mazzucchelli, Emanuela Porrello, Stefano Govoni and ... to basal levels and reached a maximum of approximately threefold increase at 1 00 nMPMA. In contrast SYDe showed a slight and not signiﬁcantincrease in sAPPa release at all concentrations of ... an expression plasmid containing PKCaantisense cDNA (SYa4) and a cell line transfected with an expression plasmid containing PKCe antisense cDNA(SYDe) [27]. Western blot analysis showed that...

Xem thêm

Từ khóa: Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long Phát hiện xâm nhập dựa trên thuật toán k means Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khí Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui ro Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015 QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ