Identification of an osteopontin-like protein in fish associated with mineral formation 2 Vera G. Fonseca*, Vincent Laize ´ *, Marta S. Valente and M. Leonor Cancela Centro de Cie ˆ ncias do Mar (CCMAR), Universidade do Algarve, Faro, Portugal Fish, by sharing with mammals a large number of impor- tant characteristics (e.g. organ systems, developmental and physiological mechanisms), has become a suitable model organism to study vertebrate physiological pro- cesses, particularly skeletal development and tissue min- eralization [1–3]. While intensively studied in mammals for decades, mechanisms of bone formation and skeleto- genesis have been under scrutiny in fish only in the past few years. Consequently, genetic resources, tools and methods that may be used towards the study of tissue mineralization are limited in fish. In an effort to develop that aspect, numerous studies have been carried out recently in a number of fish species, including several freshwater fish (e.g. zebrafish, goldfish, Nile tilapia and common carp) and one marine fish (gilthead seabream). The latter is among the most important marine species grown in European farms, and because hatchery-reared seabream larvae develop high levels of skeletal malfor- mations [4–6], it has become the focus of recent studies related to skeletogenesis. As a result, 4 (a) various genes involved in seabream ossification have been cloned (e.g. osteocalcin, matrix Gla protein, osteonectin, bone morphogenetic protein 2, alkaline phosphatase) [7–11] (V. Laize ´ & M. Leonor Cancela, unpublished results) 5 , Keywords bone-derived cell line; gilthead seabream Sparus aurata (Teleostei); osteopontin; subtractive library; tissue mineralization Correspondence M. Leonor Cancela, Centro de Cie ˆ ncias do Mar (CCMAR), Universidade do Algarve, Campus de Gambelas, 8005-139 Faro, Portugal Fax: +351 289800069 Tel: +351 289800971 E-mail: lcancela@ualg.pt Website: http://www.ualg.pt/fcma/edge/ web/ *These authors contributed equally to this work (Received 11 April 2007, revised 21 June 2007, accepted 2 July 2007) doi:10.1111/j.1742-4658.2007.05972.x Fish has been recently recognized as a suitable vertebrate model and repre- sents a promising alternative to mammals for studying mechanisms of tis- sue mineralization and unravelling specific questions related to vertebrate bone formation. The recently developed Sparus aurata (gilthead seabream) osteoblast-like cell line VSa16 was used to construct a cDNA subtractive library aimed at the identification of genes associated with fish tissue min- eralization. Suppression subtractive hybridization, combined with mirror orientation selection, identified 194 cDNA clones representing 20 different genes up-regulated during the mineralization of the VSa16 extracellular matrix. One of these genes accounted for 69% of the total number of clones obtained and was later identified as the 3 S. aurata osteopontin-like gene. The 2138-bp full-length S. aurata osteopontin-like cDNA was shown to encode a 374 amino-acid protein containing domains and motifs charac- teristic of osteopontins, such as an integrin receptor-binding RGD motif, a negatively charged domain and numerous post-translational modifications (e.g. phosphorylations and glycosylations). The common origin of mamma- lian osteopontin and fish osteopontin-like proteins was indicated through an in silico analysis of available sequences showing similar gene and protein structures and was further demonstrated by their specific expression in min- eralized tissues and cell cultures. Accordingly, and given its proven associa- tion with mineral formation and its characteristic protein domains, we propose that the fish osteopontin-like protein may play a role in hard tissue mineralization, in a manner similar to osteopontin in higher vertebrates. Abbreviations 1 Asp, aspartic acid; ECM, extracellular matrix; EST, expressed sequence tag; Gly, glycine; Glu, glutamic acid; MOS, mirror orientation selection; OP-L, osteopontin-like; SaOP-L, Sparus aurata osteopontin-like; Ser, serine; SSH, suppression subtractive hybridization. 4428 FEBS Journal 274 (2007) 4428–4439 ª 2007 The Authors Journal compilation ª 2007 FEBS (b) cell lines representing different bone-related cell types have been obtained [12], (c) expressed sequence tag (EST) 6 collections have been developed [13,14], (d) DNA microarrays have been built [13,14] and (e) a radiation hybrid panel has been developed for seabream [15]. The present study aimed to identify fish genes involved in the mineralization of the extracellular matrix of a seabream osteoblast-like cell line [12] using a subtractive cloning approach. A cDNA subtractive library was first constructed using the suppression sub- tractive hybridization technique (SSH) [16], then impro- ved using the mirror orientation selection (MOS) in order to eliminate false positives [17]. This approach allowed the identification of 194 cDNA clones represent- ing 20 different up-regulated osteoblast-related genes. Results Up-regulated genes during mineralization of VSa16 osteoblast-like cells VSa16 cells were cultured for 3 weeks under control or mineralizing conditions then stained using the von Kossa method to demonstrate extracellular matrix (ECM) 7 mineralization of treated cells (results not shown). Two cDNA libraries were constructed using RNA extracted from control or treated cells, then sub- tracted (mineralization minus control), enriched and normalized according to the MOS method. A total of 1600 bacterial clones containing fragments of up-regu- lated cDNAs inserted into pGEM-T Easy were screened in situ. From these, 194 were confirmed to be differen- tially expressed 8 and cDNA fragments corresponding to each clone were sequenced and identified by similarity search using blast facilities at the National Center for Biotechnology Information. Sequence analysis identi- fied 20 different cDNAs (Table 1), encoding different classes of proteins involved in a wide range of cell mechanisms, including regulation of ECM mineraliza- tion (n ¼ 1), cellular metabolism (n ¼ 8) and cell orga- nization and biogenesis (n ¼ 2). The remaining genes (n ¼ 9) were found to encode proteins with unknown function. Up-regulated expression of these 20 genes was confirmed by reverse northern analysis (results not shown). Interestingly, the most up-regulated gene was also the most represented (69% of all occurrences, rep- resented by three different fragments later shown to be part of the same cDNA). This gene (i.e. the fragments obtained from SSH) exhibited the highest similarity with fish osteopontin-like (OP-L) 9 genes (e.g. those of rainbow and brook trouts) and, to a lesser extent, with mammalian osteopontin genes, and was consequently termed Sparus aurata osteopontin-like (SaOP-L) gene 10 . Cloning and reconstruction of OP-L sequences Specific PCR primers (Table 2) were designed according to the three nonoverlapping cDNA fragments obtained Table 1. Genes up-regulated during the mineralization of VSa16 cells. 29 Biological process a Gene name Occurrence BLASTX Species E-value Development Regulation of ECM mineralization Osteopontin-like ⁄ Spp1 133 b Fish 2e-08 Cellular process Cellular metabolism Coenzyme metabolism Short-chain dehydrogenase 31 c Insect 2e-19 Nucleic acid metabolism Cartilage intermediate layer protein-like 2 Fish 3e-12 Electron transport Cytochrome c oxidase subunit I 3 Fish E < e-100 Cytochrome c oxidase subunit VIb 1 Fish 1e-08 Protein modification Ubiquitin-conjugating enzyme E2 2 Fish 4e-17 Protein synthesis Ribosomal protein L23a 1 Fish 2e-39 DNA transposition Transposase-like 1 Fish 4e-01 Glucose metabolism Glucose-6-phosphate-1-dehydrogenase 1 Fish 7e-69 Cell organization and biogenesis Cytoskeleton organization Transgelin-like 2 Fish 4e-03 Regulation of cell growth S100-like calcium-binding protein 1 Fish 7e-08 Unknown Unknown 1–9 1–4 E > 1 a According to the definition of the Gene Ontology database at http://www.geneontology.org. b Three different fragments corresponding to different regions of osteopontin-like cDNA were identified (occurrence ¼ 2, 8 and 123 clones). c Two different fragments corresponding to different regions of short-chain dehydrogenase cDNA were identified (occurrence ¼ 20 and 11 clones). V. G. Fonseca et al. Fish osteopontin is associated with mineralization FEBS Journal 274 (2007) 4428–4439 ª 2007 The Authors Journal compilation ª 2007 FEBS 4429 from SSH (a, b and c in Fig. 1A) and used in a combi- nation of RACE and standard PCR amplifications to amplify overlapping fragments (d, e and f in Fig. 1A). A 2138-bp sequence corresponding to the full-length cDNA of SaOP protein (GenBank accession number AY651247) was finally reconstructed (Fig. 1A,B). An ATG initiation codon was found at position 130 with an in-frame stop codon at position 1254, generating a 1125-bp open reading frame that encoded a 374 amino- acid peptide. Analysis of the primary sequence of the protein demonstrated various domains, motifs and post- translational modifications, including (a) a 16 amino- acid transmembrane signal peptide at the N-terminus for protein secretion, (b) an integrin receptor-binding RGD motif [arginine (Arg) 178–glycine(Gly)179– aspartic acid(Asp)180], suggesting a role of SaOP-L in cell adhesion, (c) a negatively charged domain rich in Asp and glutamic acid (Glu) residues (Asp109–Glu136) and (d) 64 putative serine (Ser) and threonine phos- phorylated residues located in the target sequence of mammary gland casein kinase [S ⁄ T-X-E ⁄ S(P) ⁄ D] and casein kinase II (S-X-X-E ⁄ S(P) ⁄ D), two enzymes responsible for most phosphorylations in human osteo- pontin [18]. Searching online public databases (e.g. GenBank at http://www.ncbi.nlm.nih.gov and Ensembl at http://www.ensembl.org) using blast revealed numerous ESTs or genomic clones with high similarity to OP-L proteins. The analysis, clustering and assem- bly of these sequences permitted the reconstruction of three new OP-L sequences (two cDNAs and one gene; see supplementary Fig. S1), all of fish origin. A total of seven complete OP-L sequences (three previously annotated, three reconstructed and one cloned) have been collected for this study (Fig. 2). Interestingly, searching GenBank and Ensembl sequence databases using OP-L sequences identified only bony fish sequences (Osteichthyes) and none from mammals, birds or amphibians. Similarly, searching sequence databases using annotated osteopontin sequences identified only sequences from mammals, birds and amphibians, and none from fish. The pair- wise per cent identities among mammalian osteopontin and fish OP-L protein sequences were  60% and 40%, respectively, whereas the identity between fish and mammalian sequences was only 14% (Table 3), further confirming the weak similarity existing between the two proteins at the amino acid level. Comparison of osteopontin and OP-L sequences Despite their weak sequence similarity, we hypothe- sized that fish OP-L protein could be orthologous to mammalian osteopontin. To test this hypothesis and to determine whether osteopontin and OP-L protein have retained the same function in the course of evolu- tion, the gene and peptide structures of both proteins were investigated. Annotated osteopontin sequences were collected from GenBank and Ensembl sequence databases (seven sequences from mammals and two from birds; Fig. 2) and compared with OP-L sequences 11 . The gene structure 11 (Fig. 3A) was highly similar, exhibiting the same pattern of exon distribu- tion (four to five small exons at the 5¢ end and two lar- ger 12 exons at the 3¢ end; note that fish exons 3 and 4 have probably merged to generate exon 3 in birds and mammals) and an identical pattern of intron insertion: all occurred between two different codons (phase 0). Analysis of the protein primary structure (Fig. 3B and Table 4) identified several conserved features, including (a) similar size, molecular weight, isoelectric point and hydropathicity, (b) 13 a similar occurrence for most repre- sented residues (Asp, Glu and Ser), (c) the presence of numerous, possibly phosphorylated, O- and N-glycosy- lated residues throughout the protein (d) and similar domains (N-terminal negatively charged domain), motifs (integrin receptor-binding RGD motif) and pro- teolytic cleavage sites (thrombin). Altogether, these observations point 14 towards a common ancestral origin of osteopontin and OP-L genes and proteins. Table 2. PCR primers used to clone Sparus aurata osteopontin-like (SaOP) full-length cDNA and analyze its gene expression. Primer Sequence (5¢) to 3¢) SaOP1-F01 CGCTCCAGCCGCTGAACTCCTGAAGC SaOP2-F02 CCACCCCTCAGCCCATCGACCCTACC SaOP3-F03 GGCGGGACCTGACACCACCACTGACA SaOP2-R04 GGTAGGGTCGATGGGCTGAGGGGTGG SaOPreal-FW AAAACCCAGGAGATAAACTCAAGACAACCCA SaOPreal-RV AGAACCGTGGCAAAGAGCAGAACGAA SaRPL27a-FW AAGAGGAACACAACTCACTGCCCCAC SaRPL27a-RV GCTTGCCTTTGCCCAGAACTTTGTAG Fig. 1. SaOP-L full-length cDNA. (A) cDNA fragments obtained from the subtractive library (a, b and c) and amplified by PCR (d, e and f). (B) SaOP-L reconstructed cDNA and deduced amino acid sequences (bold). The light grey box indicates the N-terminal signal peptide, the dark grey box indicates the negatively charged region and the black box indicates the RGD motif. Putative phosphorylation located in the target sequence of the mammary gland casein kinase and casein kinase II are indicated by 32 circles (serine) or squares (threonine). The SaOP-L cDNA sequence can be retrieved from GenBank using accession number AY651247. Fish osteopontin is associated with mineralization V. G. Fonseca et al. 4430 FEBS Journal 274 (2007) 4428–4439 ª 2007 The Authors Journal compilation ª 2007 FEBS A B V. G. Fonseca et al. Fish osteopontin is associated with mineralization FEBS Journal 274 (2007) 4428–4439 ª 2007 The Authors Journal compilation ª 2007 FEBS 4431 Expression patterns of the SaOP gene Expression of the SaOP-L gene was strongly induced in osteoblast-like VSa16 and chondrocyte-like VSa13 cells after 4 weeks of mineralization (Fig. 4), suggest- ing a role of OP-L protein 15 in the process of in vitro mineralization. In addition, this observation indicated that OP-L gene expression was not limited to osteo- blasts but was associated, in both cases, with the min- eralization process. Expression of the SaOP-L gene was further investigated in the course of VSa16 ECM mineralization (data not shown) and shown to be rapidly and strongly up-regulated during this period while severely repressed in cells cultured under normal conditions, thus providing additional evidence for a role of OP-L protein 16 in the process of fish bone miner- alization. Expression of the SaOP-L gene was then investi- gated during S. aurata development using RNA pre- pared from embryos, larvae and juvenile fish. Gene expression was detected early in development, with a net increase observed 17 10 days after hatching ( 17 Fig. 5), concomitant with the progressive increase known to occur, both in number and size, of calcified skeletal structures throughout fish development. Finally, distribution of the SaOP-L transcript was investigated in a number of adult tissues, including cal- cified, mixed (partially calcified) and noncalcified tis- sues. The SaOP-L gene was expressed in all calcified and partially calcified tissues, with the highest levels detected in teeth, bone-dentary and branchial arches (Fig. 6), while absent or barely detectable in soft tis- sues (i.e. brain, skeletal muscle, heart, aorta, adipose tissue, intestine, kidney, ovary, testis, pancreas, spleen, stomach, liver, gills, urinary bladder, gall bladder, swim bladder; results not shown). This result demon- strated the specific expression of the SaOP-L gene in mineralized tissues, and further confirmed data obtained in vitro with S. aurata bone-derived cell lines. Discussion This work identified, through a subtractive cloning approach, 20 different transcripts up-regulated in min- eralized cultures of seabream bone-derived cells. Even though almost all genes obtained were new with respect to the seabream gene pool, some have already been given specific functions in other vertebrates, par- ticularly in mammals. However, genes usually associ- ated with osteoblast function (e.g. tissue nonspecific alkaline phosphatase, type I collagen, osteonectin, osteocalcin, etc.) have not been identified through this subtractive approach. The reasons why these genes were not uncovered during our study could be that (a) the screening of 1600 bacterial clones was insufficient (therefore more clones should be screened) or (b) the Ostariophysi Tetraodontiformes Acanthopterygii ProtacanthopterygiiOsteichthyes Perciformes Mammalia Rodentia Lagomorpha Bovinae Caprinae Bovidae Suidae Actiodactyla Primates Aves Vertebrates Gasterosteiformes Scientific name (common name) Acronym Accession Rattus norvegicus (Norway rat) RnOP AAA41765 Mus musculus (house mouse) MmOP AAM53974 Ovis aries (sheep) OaOP AAD38388 Bos taurus (domestic cattle) BtOP AAX62809 Sus scrofa (pig) SsOP CAA34594 Homo sapiens (human) HsOP AAA86886 Oryctolagus cuniculus (European rabbit) OcOP BAA03980 Gallus gallus (chicken) GgOP AAA18584 Coturnix japonica (Japanese quail) CjOP AAF63330 Danio rerio (zebrafish) DrOP-L AAT39545 Pimephales promelas (fathead minnow) PpOP-L Reconstructed a Oncorhynchus mykiss (rainbow trout) OmOP-L AAG35656 Salvelinus fontinalis (brook trout) SfOP-L AAG49534 Tetraodon nigroviridis (green pufferfish) TnOP-L Reconstructed a Sparus aurata (gilthead seabream) SaOP-L AAV65951 Gasterosteus aculeatus (three spined stickleback) GaOP-L Reconstructed a Fig. 2. Osteopontin and osteopontin-like sequences used in this study and taxonomy of represented species. Taxonomic data were retrieved December 20, 2005 from the Integrated Taxonomic Information System at http://www.itis.usda.gov. a, see the supplementary Fig. S1. Fish osteopontin is associated with mineralization V. G. Fonseca et al. 4432 FEBS Journal 274 (2007) 4428–4439 ª 2007 The Authors Journal compilation ª 2007 FEBS MOS technique, used to reduce the number of back- ground clones, might have decreased cDNA species diversity in the subtracted library, as already seen in other studies (Ricardo 18 B. Leite, CCMAR, University of Algarve, Portugal, personal communication). Alter- natively, some of these genes may be represented by cDNA fragments whose identity was not unraveled through sequence comparison. From the analysis of clone abundance in the SSH library, the SaOP-L gene was clearly the most highly expressed and was the focus of this work. Fish OP-L protein is probably orthologous to mammalian osteopontin The most abundant and up-regulated gene obtained from the subtractive approach was termed OP-L, in agreement to its similarity with annotated trout [19] sequences and the proposed affiliation of these sequences with mammalian osteopontin. The in silico analysis of available sequences (annotated, cloned and reconstructed) clearly demonstrated the overall conservation of both gene (i.e. similar pattern for exon size and identical phase of intron insertion) and protein (i.e. an acidic Asp-rich domain, an RGD motif, a thrombin cleavage site and numerous puta- tive phosphorylated residues) structures between fish OP-L and mammalian osteopontin proteins; we there- fore concluded that the fish protein is probably the ortholog 19 of mammalian osteopontin. The weak simi- larity observed at the amino acid level indicates 20 that both proteins have diverged significantly during evo- lution and might have developed distinct functions. By using similar evidence 21 (e.g. from sequence compari- son) but a more restricted set of sequences, Kawasaki and colleagues have drawn a similar conclusion concerning zebrafish NOP ⁄ OP-L and mammalian SPP1 ⁄ OP proteins [20] and have proposed that OP-L protein 22 and osteopontin may have a similar cellular role (i.e. as a modulator of hydroxyapatite crystalliza- tion) but a distinct function because of the differences observed in their amino acid content in acidic clus- ters. The gene expression pattern further supports the idea that OP-L protein 23 and osteopontin are indeed orthologs: they are both strongly expressed in calcified tissues (bone and calcified cartilage) and up-regulated during the mineralization process [21,22]. These data, combined with the absence of data describing Table 3. Pairwise per cent identities among osteopontin and osteopontin-like protein sequences. Light grey, mammals; dark grey, fish; white, birds. Bt, Bos taurus (domestic cattle); Cj, Coturnix japonica (Japanese quail); Dr, Danio rerio (zebrafish); Ga, Gasterosteus aculeatus (three spined stickleback); Gg, Gallus gallus (chicken); Hs, Homo sapiens (human); Mm, Mus musculus (house mouse); Oa, Ovis aries (sheep); Oc, Oryctolagus cuniculus (European rabbit); Om, Onchorynchus mykiss (rainbow trout); Pp, Pimephales promelas (fathead min- now); Rn, Rattus norvegicus (Norway rat); Sa, Sparus aurata (gilthead seabream); Sf, Salvenilus fontinalis (brook trout); Ss, Sus scrofa (pig); Tn, Tetraodon nigroviridis (spotted green pufferfish). Diagonal values in black boxes represent the sequence length. Rn 317 Mammals Birds Fish % Mm 79 294 60 ± 11 Oa 48 50 278 23 ± 01 91 ± 00 Bt 49 51 92 278 14 ± 02 10 ± 01 40 ± 16 Mammals Birds Fish Ss 54 54 63 66 303 Hs 61 63 59 62 68 314 Oc 55 56 51 52 60 68 314 Gg 22 22 25 25 23 23 23 264 Cj 22 21 25 24 21 22 22 91 264 Dr 14 14 13 13 14 14 15 10 9 305 Pp 14 14 12 12 13 13 14 9 9 74 297 Om 17 16 15 15 15 16 14 11 11 35 35 347 Sf 17 16 15 15 15 17 16 11 11 37 37 89 359 Tn 11 11 11 10 11 12 12 8 8 24 23 31 30 330 Sa 17 16 13 13 15 17 16 10 10 33 35 38 40 49 374 Ga 17 15 12 12 14 15 15 9 8 33 34 36 36 43 57 323 % Rn Mm Oa Bt Ss Hs Oc Gg Cj Dr Pp Om Sf Tn Sa Ga V. G. Fonseca et al. Fish osteopontin is associated with mineralization FEBS Journal 274 (2007) 4428–4439 ª 2007 The Authors Journal compilation ª 2007 FEBS 4433 osteopontin in fish or an OP-L protein in mammals, favor the assumption that OP-L protein is indeed the fish equivalent of mammalian osteopontin. OP-L protein plays a role in the process of mineralization Osteopontin is a multifaceted protein [23–25], which has been associated in mammals with multiple phy- siological and pathological processes, in particular mineralization [26–28], and is ubiquitously expressed in adult mammalian organisms [29–32]. In this study, OP-L gene expression was detected in calcified tis- sues or in tissues showing some degree of mineral accumulation, but not in soft tissues. Previous find- ings in adult brook trout [19] have shown some expression of an 24 OP-L gene in soft tissues (mainly in testis and ovulatory ovary, and to a lesser extent in kidney, gills and skin), but this has not been 25 investigated in calcified tissues. Differences in tissue distribution of OP-L gene expression observed when comparing trout and seabream results (a comparison limited to soft tissues) may be explained by the recent genome duplication event that specifically affected Salmonids [9,33] and probably not Sparids. If the brook trout genome has two copies of the OP-L gene, as seen for other mineralization-related genes (e.g. osteonectin), it would be expected that the two isoforms show different patterns of tissue distribution and ⁄ or regulation, a common feature associated with gene duplication. However, we can- not rule out the fact that differences in gene expres- sion in soft tissues could be related to different Table 4. Selected features of osteopontin (mammals) and osteo- pontin-like (fish) proteins. CKII, casein kinase II; MGCK, mammary gland casein kinase. Asn, asparginine; Asp, aspartic acid 30 ; Glu, glutamic acid; Thr, threonine. Features Mammals (n ¼ 7) Fish (n ¼ 7) Size (amino acids) 300 ± 17 334 ± 28 Molecular mass (kDa) a 33.4 ± 2.0 35.2 ± 2.6 pI a 4.4 ± 0.1 3.9 ± 0.1 Hydropathicity a,b )1.14 ± 0.08 )0.84 ± 0.08 Asp+Glu+Ser (%) 39 ± 2 39 ± 2 MGCK ⁄ CKII phosphorylation sites 40 ± 2 53 ± 7 N-glycosylated residues (Asn) c 1±1 1±1 O-glycosylated residues (Thr) d 7±3 23±6 RGD adhesion motif 1 1 Thrombin cleavage e 11 f Negatively charged domain 1 1 a Predicted using PROTPARAM at http://www.expasy.org. b GRAVY (grand average of hydropathicity). c Predicted using NETNGLYC at http://www.cbs.dtu.dk. d Predicted using NETOGLYC at http://www. cbs.dtu.dk. e Predicted using PEPTIDECUTTER at http://www.expasy. org. f Except in the predicted sequence of Gasterosteus aculeatus osteopontin-like (GaOP-L) 31 . Control Control Relative SaOP-L gene expression SaOP-L SaRPL27a VSa13 VSa13 VSa16 VSa16 Mineral. Mineral. Control Control Mineral. Mineral. N.D. N.D. N.D. N.D. Control Mineralization 1 0 2 3 4 5 Fig. 4. Relative SaOP-L gene expression in VSa16 and VSa13 cells cultured under control or mineralizing conditions. Top panel, SaOP-L and SaRPL27a signals after autoradiography; bottom panel, SaOP-L relative gene expression normalized with RPL27a. ND, not detected. Human Chicken Bovine Mouse Zebrafish Tetraodon 200 bp A B SP RGD RGD E-, D-rich MP SP D-rich MP OP OP - - like like Fish Fish OP OP Mammals Mammals Thrombin Thrombin cleavage cleavage N N O O Negatively Negatively - - charged charged cluster cluster O O N N N N 0000 00000 00000 00000 0 00000 0 00000 0 Fig. 3. Osteopontin and osteopontin-like gene and protein struc- ture. (A) Structural organization of osteopontin-like (tetraodon and zebrafish) and osteopontin (chicken, bovine, mouse and human) coding sequences at the gene level. Grey boxes indicate exons (or part of exons) representing the coding sequence, starting from the translation initiation codon and ending at the translation termination codon. The phase of intron insertion is indicated in 33 black triangles and is defined according to Patthy [50]. (B) Structural organization of osteopontin-like (fish) and osteopontin (mammals) proteins. MP, mature peptide; N and O, predicted N- and O-linked glycosylations, respectively; SP, signal peptide. Fish osteopontin is associated with mineralization V. G. Fonseca et al. 4434 FEBS Journal 274 (2007) 4428–4439 ª 2007 The Authors Journal compilation ª 2007 FEBS developmental or physiological stages of the speci- mens used in both studies, as evidenced by the regu- lation of OP-L gene expression in brook trout ovary during ovulation [19]. The comparison of fish OP-L protein with mamma- lian osteopontin expression patterns indicates that both proteins may play a similar role in calcified tissues and gonads, for example in bone remodeling by mediating osteoclast attachment to the mineralized bone matrix during resorption [23,34–36] and ⁄ or in matrix minera- lization by regulating calcium phosphate crystal deposition [26,37–39], and in gonads by preventing calcium-containing-crystal aggregation 26 [40,41]. The restricted tissue distribution of the OP-L gene tran- script also indicates that fish protein may be less pleio- tropic than that from mammals. Finally, the massive up-regulation of OP-L gene expression during in vitro mineralization of VSa16 (osteoblast-like) and VSa13 (chondrocyte-like) ECM is highly suggestive of a role of the OP-L protein in mineralization, which is likely to be relevant based on the highly significant induction observed, and further emphasizes the importance of fish as a model to understand osteopontin function. The pattern of developmental expression found for osteopontin is consistent with its involvement in the early mechanisms of ossification, which start in S. aurata at early larval stages and are continuous until 70–90 days after hatching [42–44]. In addition, the later OP-L gene expression detected in fish 27 130 days after hatching could also be related to ongo- ing bone remodeling, which occurs at a later stage during skeletal development ⁄ growth. In conclusion, our results indicate that OP-L protein is probably the fish ortholog to mammalian osteopon- tin, and is likely to play a role in the mineralization process under physiological conditions. Experimental procedures Materials Tissue culture medium (DMEM), fetal bovine serum, anti- biotics (penicillin and streptomycin), antimycotics (fungi- zone), trypsin-EDTA and l-glutamine were purchased from Invitrogen (Carlsbad, CA, USA). Tissue culture plates were purchased from Sarstedt (Nu ¨ mbrecht, Germany). All other reagents were purchased from Sigma-Aldrich (St Louis, MO, USA), unless otherwise stated. 0 1 2 3 4 5 6 7 8 9 10 U/E851210141824 3 6 1020374861677582130 Cells Hours post fertilization Days post hatching SaOP-L relative gene expression Maternal De novo transcription Fig. 5. Relative SaOP-L gene expression during development. Values are the mean of three independent real-time PCR experi- ments. SaOP-L relative gene expression was normalized with RPL27a. U ⁄ E, unfertil- ized eggs. 0 1 2 3 4 5 6 7 8 9 10 TE Bd Bv Bs Bo SC BA CA Fso Fsp SK E TO Calcified Mixed SaOP-L relative gene expression Fig. 6. Relative SaOP-L gene expression in adult tissues. Values are the mean of three independent real-time PCR experiments. SaOP-L relative gene expression was normalized with RPL27a. BA, branchial arch; Bd, bone-dentary; Bo, bone-opercula; Bs, bone-skull; Bv, bone-vertebra; CA, cartilage; E, eye; Fso, fin-soft rays; Fsp, fin- spiny rays; SC, scale; SK, skin; TE, teeth; TO, tongue. V. G. Fonseca et al. Fish osteopontin is associated with mineralization FEBS Journal 274 (2007) 4428–4439 ª 2007 The Authors Journal compilation ª 2007 FEBS 4435 Cell culture and extracellular matrix mineralization S. aurata VSa16 and VSa13 bone-derived cells were cul- tured and maintained as described by Pombinho and col- leagues [12]. Briefly, cells were routinely grown in DMEM supplemented with 10% fetal bovine serum, 1% penicil- lin ⁄ streptomycin, 1% fungizone and 2 mml-glutamine, and incubated at 33 °C in a 10% CO 2 humidified atmosphere. ECM mineralization was induced by supplementing the cul- ture medium with 50 lgÆ mL )1 of l-ascorbic acid, 10 mm b-glycerophosphate and 4 mm CaCl 2 . Mineral deposition was detected using the von Kossa staining method and observed under an Axiovert 25 inverted microscope (Zeiss, Go ¨ ttingen, Germany) equipped with phase contrast. Subtracted cDNA library construction and cloning Total RNA was isolated from cultured cells, as described by Chomczynski & Sacchi [45], and poly(A+) RNA was extracted using the Oligotex Mini kit (Qiagen, Hilden, Ger- many). SSH was carried out using 2 lg of poly(A+) RNA and the PCR-Select cDNA Subtraction kit (Clontech, Palo Alto, CA, USA) following the manufacturer’s protocol. Subtraction was obtained using cDNAs prepared from min- eralized cells as the tester sample and cDNAs prepared from control cells as the driver sample. To normalize and eliminate false-positive cDNA clones, SSH was combined with the MOS technique, as described by Rebrikov and colleagues [17]. Secondary PCR products obtained from the forward subtracted SSH were inserted into the pGEM-T Easy vector (Promega, Madison, WI, USA) and the result- ing plasmids were transformed into DH5a competent cells. Positive bacterial clones were selected on Luria–Bertani agar plates containing ampicillin (100 l gÆmL )1 ), X-Gal (80 lgÆmL )1 ) and isopropyl thio-b-d-galactoside (IPTG) (0.5 mm) then grown for 20 h at 37 °C in 96-well plates, each well containing 100 lL of Luria–Bertani supplemented with ampicillin. In situ differential screening Adaptor-free cDNAs from forward and reverse subtrac- tions were radiolabeled according to the Clontech protocol PT1117-1 with [ 32 P]dCTP[aP] (3000 CiÆmL )1 ; Amersham Biosciences, Piscataway, NJ, USA) using the Rediprime II kit (Amersham Biosciences) and purified from unincorpo- rated radionucleotides using Microspin S-200 HR columns (Amersham Biosciences). Bacterial clones were blotted onto Hybond-XL nylon membranes (Amersham Biosciences), as described by Fonseca and colleagues [46]. Membranes were hybridized overnight at 42 °C in ULTRAhyb solution (Ambion, Austin, TX, USA) using probes prepared from forward or reverse subtractions, and washed twice (5 min each wash) in low-stringency solution [2 · NaCl ⁄ Cit, 0.1% SDS (1 · NaCl ⁄ Cit is 0.15 m NaCl and 15 mm sodium citrate), pH 7.0] and 2 · 15 min in high-stringency solution (0.1 · NaCl ⁄ Cit, 0.1% SDS) at 55 °C. Membranes were then exposed to a Kodak XAR film (Amersham Biosciences). DNA sequencing and identification DNA from selected clones was sequenced (Macrogen, Seoul, South Korea) and compared with sequences in the GenBank database using blastx and tblastx facilities at the National Center for Biotechnology Information 28 (NCBI, Rockville Pike, Bethesda, MD, USA, http://www.ncbi.nlm.nih.gov). Reverse northern blot analysis DNA from selected clones was PCR amplified using NP1 and NP2R primers (Clontech) and blotted in quadruplicate onto Hybond-XL nylon membranes using the Multi-Print manual arrayer (V & P Scientific, San Diego, CA, USA). DNA was cross-linked to the membrane for 3–4 min under UV and for 2 h at 80 °C. Membranes were probed, as described above, with radiolabeled VSa16 poly(A+) RNA (from either control or mineralized samples). Signal inten- sity was estimated by densitometric methods using quan- tity one software (Bio-Rad, Hercules, CA, USA). The relative expression of each gene was normalized with S. aurata ribosomal protein L27a (SaRPL27a, GenBank accession number AY188520) signals. Northern blot analysis Ten micrograms of total RNA was fractionated on a 1.2% formaldehyde-agarose gel and transferred onto a Hybond- XL nylon membrane by capillary blotting using 10 · NaCl ⁄ Cit. Membranes were probed, as described above, using radiolabeled S. aurata OP-L (GenBank acces- sion number AY651247) or SaRPL27a probes, and the sig- nal intensity was determined by densitometric methods using quantity one software (Bio-Rad). Relative OP-L gene expression was normalized with SaRPL27a signals. PCR, RACE-PCR and cDNA cloning All PCRs were performed using a 1 : 50 dilution of the VSa16 library constructed from poly(A+) RNA (control and mineralized) using the Marathon cDNA Amplification kit (Clontech). Amplification of the 5¢- and 3¢-RACE-PCR products was performed using the Advantage cDNA poly- merase mix (Clontech) and AP1 ⁄ AP2 primers combined with specific primers designed according to S. aurata OP-L cDNA fragments previously obtained (Table 2). PCR frag- ments were size-fractionated by agarose-gel electrophoresis, Fish osteopontin is associated with mineralization V. G. Fonseca et al. 4436 FEBS Journal 274 (2007) 4428–4439 ª 2007 The Authors Journal compilation ª 2007 FEBS purified and inserted into the pGEM-T Easy vector. DNA inserts were sequenced and identified as described above. Analysis of gene expression by quantitative real-time PCR Real-time PCR assays were performed using the iCycler PCR system and software to quantify nucleic acids (Bio- Rad). Total RNA (1 lg) was reverse-transcribed at 37 °C for 1 h using the Moloney-murine leukemia virus (M-MLV) reverse transcriptase (Invitrogen), RNase Out (Invitrogen) and specific reverse primers SaOPreal-RV and SaRPL27a-RV for OP-L and ribosomal protein L27a cDNAs. The reaction mixture, containing 1 · iQ SYBR Green I mix (Bio-Rad), 0.4 lm forward and reverse primers and 100 ng of reverse-transcribed RNA, was subjected to the following PCR conditions: 4 min at 95 °C, and 55 cycles of 30 s at 95 °C and 45 s at 68 °C. RPL27a relative gene expression was used to normalize OP-L gene expres- sion levels. Fragments of 153 bp for OP-L cDNA and 160 bp for RPL27a cDNA were amplified using the primer sets SaOPreal-FW ⁄ SaOPreal-RV and SaRPL27a-FW ⁄ SaRPL27a-RV, respectively. Protein sequence analysis Signal peptide, and O- and N-linked glycosylation sites, were predicted using signalp 3.0 [47], netnglyc 1.0 and netoglyc 3.1 [48] facilities at http://www.cbs.dtu.dk. Protein domains were identified using InterProScan facili- ties at http://www.ebi.ac.uk. Percentage protein identity was calculated using the Sequence Manipulation Suite [49] available at http://www.bioinformatics.org. Acknowledgements Authors thank Marta S. Rafael from the CCMAR, University of Algarve, Faro, Portugal, for her techni- cal help in the course of gene identification. The authors are also grateful to Ricardo B. Leite and Dr Paulo J. Gavaia for data on the MOS technique and fish skeletogenesis, respectively. VGF was partially supported by CCMAR funding. This work was par- tially supported by grants POCTI ⁄ BCI ⁄ 48748⁄ 2002 from the Portuguese Science and Technology Founda- tion (FCT) and GOCE-CT-2004-505403 (Marine Genomics Europe) from the European Commission under the 6th Framework Program. References 1 Gavaia PJ, Sarasquete C & Cancela ML (2000) Detection of mineralized structures in early stages of development of marine Teleostei using a modified alcian blue-alizarin red-double staining technique for bone and cartilage. Biotech Histochem 75, 79–84. 2 Nissen RM, Amsterdam A & Hopkins N (2006) A zebrafish screen for craniofacial mutants identifies wdr68 as a highly conserved gene required for endothelin-1 expression. BMC Dev Biol 6, 28. 3 Fisher S, Jagadeeswaran P & Halpern ME (2003) Radiographic analysis of zebrafish skeletal defects. Dev Biol 264, 64–76. 4 Andrades JA, Becerra J & Fernandez-Llebrez P (1996) Skeletal deformities in larval, juvenile and adult stages of cultured gilthead sea bream (Sparus aurata L.). Aquaculture 141, 1–11. 5 Carrillo J, Koumoundouros G, Divanach P & Martinez J (2001) Morphological malformations of the lateral line in reared gilthead sea bream (Sparus aurata L 1758). Aquaculture 192, 281–290. 6 Koumoundouros G, Oran G, Divanach P, Stefanakis S & Kentouri M (1997) The opercular complex deformity in intensive gilthead sea bream (Sparus aurata L.) larvi- culture. Moment of apparition and description. Aqua- culture 156, 165–177. 7 Pinto JP, Ohresser MCP & Cancela ML (2001) Cloning of the bone Gla protein gene from the teleost fish Sparus aurata. Evidence for overall conservation in gene organization and bone-specific expression from fish to man. Gene 270, 77–91. 8 Pinto JP, Conceic¸ a ˜ o N, Gavaia PJ & Cancela ML (2003) Matrix Gla protein gene expression and protein accumulation colocalize with cartilage distribution during development of the teleost fish Sparus aurata. Bone 32, 201–210. 9 Laize ´ V, Pombinho AR & Cancela ML (2005) Charac- terization of Sparus aurata osteonectin cDNA and in silico analysis of protein conserved features: Evidence for more than one osteonectin in Salmonidae. Biochimie 87, 411–420. 10 Cancela ML, Williamson MK & Price PA (1995) Amino acid sequence of bone Gla protein from the african clawed toad Xenopus laevis and the fish Sparus aurata. Int J Pept Protein Res 46, 419–423. 11 Simes DC, Williamson MK, Ortiz-Delgado JB, Viegas CSB, Price PA & Cancela ML (2003) Purification of matrix Gla protein from a marine teleost fish, Argyroso- mus regius: Calcified cartilage and not bone as the pri- mary site of MGP accumulation in fish. J Bone Miner Res 18, 244–259. 12 Pombinho AR, Laize ´ V, Molha DM, Marques SMP & Cancela ML (2004) Development of two bone-derived cell lines from the marine teleost Sparus aurata; evidence for extracellular matrix mineralization and cell-type-spe- cific expression of matrix Gla protein and osteocalcin. Cell Tissue Res 315, 393–406. 13 Sarropoulou E, Kotoulas G, Power DM & Geisler R (2005) Gene expression profiling of gilthead sea bream V. G. Fonseca et al. Fish osteopontin is associated with mineralization FEBS Journal 274 (2007) 4428–4439 ª 2007 The Authors Journal compilation ª 2007 FEBS 4437 [...]... for the evolution of vertebrate mineralized tissue Proc Natl Acad Sci USA 101, 11356–11361 Cowles EA, DeRome ME, Pastizzo G, Brailey LL & Gronowicz GA (1998) Mineralization and the expression of matrix proteins during in vivo bone development Calcif Tissue Int 62, 74–82 Sommer B, Bickel M, Hofstetter W & Wetterwald A (1996) Expression of matrix proteins during the development of mineralized tissues... murine gene encoding secreted phosphoprotein 1 (osteopontin): promoter structure, activity, and induction in vivo by estrogen and progesterone Gene 100, 163–171 31 Kerr JM, Fisher LW, Termine JD & Young MF (1991) The cDNA cloning and RNA distribution of bovine osteopontin Gene 108, 237–243 32 Nomura S, Wills AJ, Edwards DR, Heath JK & Hogan BL (1988) Developmental expression of 2ar (osteopontin) and... (2005) Importance of phosphorylation for osteopontin regulation of biomineralization Calcif Tissue Int 77, 45–54 38 Ito S, Saito T & Amano K (2004) In vitro apatite induction by osteopontin: interfacial energy for hydroxyapatite nucleation on osteopontin J Biomed Mater Res 69, 11–16 39 Pampena DA, Robertson KA, Litvinova O, Lajoie G, Goldberg HA & Hunter GK (2004) Inhibition of hydroxyapatite formation. .. Christensen B, Nielsen MS, Haselmann KF, Petersen TE & Sorensen ES (2005) Post-translationally modified residues of native human osteopontin are located in clusters: identification of 36 phosphorylation and five O-glycosylation sites and their biological implications Biochem J 390, 285–292 Bobe J & Goetz FW (2001) A novel osteopontin-like protein is expressed in the trout ovary during ovulation FEBS Lett 489,... (2000) Osteopontin: a versatile regulator of in ammation and biomineralization Matrix Biol 19, 615–622 Denhardt DT & Guo X (1993) Osteopontin: a protein with diverse functions FASEB J 7, 1475–1482 ´ ´ Chabas D (2005) L’osteopontine, une molecule aux multiples facettes Me´decine ⁄ Sciences 21, 832–838 Beck GR, Zerler B & Moran B (2000) Phosphate is a specific signal for induction of osteopontin gene expression... mineralization terization of mammalian mucin-type O-glycosylation sites Glycobiology 15, 153–164 49 Stothard P (2000) The sequence manipulation suite: JavaScript programs for analyzing and formatting protein and DNA sequences Biotechniques 28, 1102– 1104 50 Patthy L (1987) Intron-dependent evolution: preferred types of exons and introns FEBS Lett 214, 1–7 Supplementary material The following supplementary... Faustino M & Power DM (2001) Osteologic development of the viscerocranial skeleton in sea bream: alternative ossification strategies in teleost fish J Fish Biol 58, 537–572 45 Chomczynski P & Sacchi N (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate phenol chloroform extraction Anal Biochem 162, 156– 159 ´ ´ 46 Fonseca VG, Lago-Leston A, Laize V & Cancela ML (2005) Rapid identification. .. decreasing bone mineral crystallinity and content during calcium deficiency Calcif Tissue Int 73, 86–92 35 Denhardt DT & Noda M (1998) Osteopontin expression and function: Role in bone remodeling J Cell Biochem 72, 92–102 36 Reinholt FP, Hultenby K, Oldberg A & Heinegard D (1990) Osteopontin - a possible anchor of osteoclast to bone Proc Natl Acad Sci USA 87, 4473–4475 37 Gericke A, Qin C, Spevak L, Fujimoto... osteopontin phosphopeptides Biochem J 378, 1083–1087 40 Luedtke CC, McKee MD, Cyr DG, Gregory M, Kaartinen MT, Mui J & Hermo L (2002) Osteopontin expression and regulation in the testis, efferent ducts, and epididymis of rats during postnatal development through to adulthood Biol Reprod 66, 1437–1448 41 Brunswig-Spickenheier B & Mukhopadhyay AK (2003) Expression of osteopontin (OPN) mRNA in bovine ovarian... Boskey A (2003) Bone mineral crystal size Osteoporos Int 14, 16–21 4438 28 Huang W, Carlsen B, Rudkin G, Berry M, Ishida K, Yamaguchi DT & Millera TA (2004) Osteopontin is a negative regulator of proliferation and differentiation in MC3T3-E1 pre-osteoblastic cells Bone 34, 799–808 29 Yoon K, Buenaga R & Rodan GA (1987) Tissue specificity and developmental expression of rat osteopontin Biochem Biophys . Identification of an osteopontin-like protein in fish associated with mineral formation 2 Vera G. Fonseca*, Vincent Laize ´ *, Marta S. Valente and M Osteopontin and osteopontin-like gene and protein struc- ture. (A) Structural organization of osteopontin-like (tetraodon and zebrafish) and osteopontin (chicken,