Báo cáo khóa học: Functional properties of the protein disulfide oxidoreductase from the archaeon Pyrococcus furiosus A member of a novel protein family related to protein disulfide-isomerase doc
Báo cáo khóa học: Functional properties of the protein disulfide oxidoreductase from the archaeon Pyrococcus furiosus A member of a novel protein family related to protein disulfide-isomerase doc
... Pedone et al.(Eur. J. Biochem. 271) Ó FEBS 2004 Functional properties of the protein disulfide oxidoreductase from the archaeon Pyrococcus furiosus A member of a novel protein family related to protein ... about protein disulfide oxidoreductases in archaea. A small redox protein w ith a molecular m ass of 12 kDawas purified from the archaeon Methanobacteriumthermoautotrophicum by McFarlan et al.[1].Thisproteincan ... Yamazaki, S., Hai-kawa,Y.,Jin-n.,o,K.,Takahashi,M.,Sekine,M.,Baba,S.,Ankai, A. , Kosugi, H., H os oyama, A. , Fu kui, S., N agai, Y.,Nishijima, K., Nakazawa, H., Takamiya, M., Masuda, S.,Funahashi,...
- 12
- 506
- 0
Tài liệu Báo cáo khoa học: Functional studies of active-site mutants from Drosophila melanogaster deoxyribonucleoside kinase Investigations of the putative catalytic glutamate–arginine pair and of residues responsible for substrate specificity docx
... Q81N-fwd:5¢-TGGGCCATGCCCTTTAACAGTTATGTCACGCTG-3¢. Q81N-rev:5¢-CAGCGTGACATAACTGTTAAAGGGCATGGCCCA-3¢. R105H-fwd:5¢-GCTAAAAATAATGGAGCACTCCATTTTTAGCGCTCGC-3¢ . R105H-rev:5¢-GCGAGCGCTAAAAATGGAGTGCTCCATTATTTTTAGC-3¢. ... R105H-rev:5¢-GCGAGCGCTAAAAATGGAGTGCTCCATTATTTTTAGC-3¢. R105K-fwd:5¢-GCTAAAAATAATGGAGAAATCCATTTTTAGCGCTCGC-3¢. R105K-rev:5¢-GCGAGCGCTAAAAATGGATTTCTCCATTATTTTTAGC-3¢Sequence verificationPlasmids of the seven mutants were transformed into ... Asp are very sim-ilar, both having a carboxylic acid functional group, the dramatically decreased catalytic rate is most likelydue to the increased distance between the catalyticbase and the...
- 10
- 504
- 0
Tài liệu Báo cáo khoa học: Functional analysis of the basic helix-loop-helix transcription factor DEC1 in circadian regulation ppt
... 5¢-AAGCTTCACCATGTACCCTGCCCACATGTACCAAGTGTAC-3¢,5¢-AAGCTTCACCATGCCGCACCGG CTCATCGAGAAAAAGAG-3¢,5¢-AAGCTTCACCATGGCAGTGGTTCTTGAACTTACCTTGAAGC-3¢ or5¢-AAGCTTCACCATGATTGCCCTGCAGAGTGGTTTACAAGCTG-3¢) ... sets of primers ( 5¢-AAGCTTGAGCGGATCCCCAGCGCGCAACCACC-3¢ and5¢-GCAGCAGGATCCTCTAGAGAGTTTAGTCTTTG-3¢ for FLAG-DEC1; and 5 ¢-GAATTCGGCGGACCAGAGAATGGACATTTCCTCAACCATC-3¢ and5¢-TCTAGACTACAGCGGCCATGGCAAGTCACTAAAGTC-3¢ ... DEC1-H5 7A; 5¢-GATGAGCCGGTGCGGCAATTTGTAGGTCTCC-3¢ and 5 ¢-GAGAAAAAGAGAGCTGACCGGATTAACGAGTGC-3¢ forDEC1-R6 5A, FLAG-DEC1-R6 5A and DEC1:4–232-R6 5A; and 5 ¢-GATGAGCCGGTGCGGCAATTTGTAGGTCTCC-3¢ and...
- 11
- 629
- 0
Tài liệu Báo cáo khoa học: Functional dissection of the Schizosaccharomyces pombe Holliday junction resolvase Ydc2: in vivo role in mitochondrial DNA maintenance pptx
... Increasing amounts of total cellular DNA were loaded on the gels, as the hybridization signal in these samples was very low. The general pattern remained the same: the 19.4-kb band wasweak and a ... intermediate is thereforecrucial for the integrity and maintenance of DNA in allorganisms including mitochondrial DNA (mtDNA).Mitochondrial DNA amounts to about 15% of the DNAcontent in Saccharomyces ... interactions with the junction thatare functionally relevant. These results indicate that deletion of the SAP motif alone affected greatly the ability of the truncated protein to bind the junction...
- 11
- 575
- 0
Tài liệu Báo cáo khoa học: Functional effects of deleting the coiled-coil motif in Escherichia coli elongation factor Ts pptx
... bindsaminoacyl-tRNA (aa-tRNA) and promotes the binding of the aa-tRNA to the A- site of the mRNA-programmedribosome. Upon codon recognition by a cognate ternarycomplex (EF-Tu–GTP–aa-tRNA), the ... that the recombinant proteins have the same number of amino acidsas the native elongation factors.Activity assays The concentration of EF-Tu active in binding guaninenucleotides, and the activity ... binding of a deacylated tRNA to the ribosome rather than by a change in the synthesis of (p)ppGpp. Deacylated tRNAhas a high codon-specific affinity for the ribosomal A site[49]. A moderate decrease...
- 12
- 502
- 0
Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin-binding adhesins fibronectin-binding protein A and fibronectin-binding protein B from Staphylococcus aureus pot
... testing in parallel of up to six different analytes, or up to six different concentrations of the same analyte, over the target surface.Concentrations, ranging from 100 to 1000 nm, of eachanalyte ... FEBSMonoclonal antibodies against FnBRs of FnBPB A panel of mouse mAbs was produced against the recombinant repetitive region of FnBPB. Analysis of mAbs binding to the recombinant FnBR indicated the generation ... wereperformed at 25 °C. The sensorgrams (time course of the SPR signal in RU)were normalized to a baseline value of 0. All sensorgramdata presented were subtracted from the correspondingdata obtained from...
- 16
- 560
- 0
Báo cáo khoa học: Physicochemical properties and distinct DNA binding capacity of the repressor of temperate Staphylococcus aureus phage /11 doc
... pBottomO1O2O2clO3O2croO1O1+–––1405'CATTTTCTTACCTCCTTAAATTTACCTATAGTATAACCCAATTATTTTTGGTATTCAGTAAAAGAATGGAGGAATTTAAATGGATATCATATTGGGTTAATAAAAACCATAAGTACAAAAAAATACACGAAAAGCAAACTTTTATGTTGACTCAAGTACACGTATCGTGTATTGTTTTTTTATGTGCTTTTCGTTTGAAAATACAACTGAGTTCATGTGCATAGCACATAAGTAGGTTTTGTAAGCGGGAGGTGACAACATGTCATCCAAAACATTCGCCCTCCACTGTTGTAC ... Malabika Das*, Amitava Bandhu, Palas K. Chanda, Biswanath Jana, RajkrishnaMondal and Subrata SauDepartment of Biochemistry, Bose Institute, Calcutta, India The basic regulatory elements that ... in the majorgroove of the DNA helix [1]. Therefore, the data alsosuggest that the interaction between CI and the opera-tor DNA may occur through the major groove of the operator DNA helix.The...
- 11
- 432
- 0
Báo cáo khoa học: Functional association of the AAA complex and the peroxisomal importomer potx
... 5¢-TTTGCATACCCTCCAAAAGAAAGCGATTATAGTAACATTAATATGCGTACGCTGCAGGTCGAC-3¢KU231 5¢-ATATATTTACAAATTTACCTATACGCTCTGAGTTGATATTACTTAATCGATGAATTCGAGCTCG-3¢KU562 5¢-CAGGGCGAAGTAGGTATTAGCCGTTTACATTAGAAAATAAGGTAGCGTACGCTGCAGGTCGAC-3¢KU699 ... 5¢-CCCCCAGATTGTAGGGTTGCTAAAACTTCTAGCGAGTATACGTACGCTGCAGGTCGAC-3¢KU1014 5¢-AAATAAGTAGGTAGGGTTTTATAAACTATTCAAATATTTCATCGATGAATTCGAGCTCG-3¢KU296 5¢-ACCCCGGGTTGAATTCAGATGGCTGCAAGTGAGATA-3¢KU1168 5¢-AACTCGAGGCGGCCGCTCATATACTCGCTAGAAGTTTTAGC-3¢K. ... 5¢-GGCCTGTGGACAATGCTAAAAGAGTAGTCAAATTATTGATTAATAGGCCACTAGTGGATCTG-3¢KU1009 5¢-GCCCAATGGTGAGAATTCCATCGACATTGGTAGCCGACTCTCCCTTATGCGTACGCTGCAGGTCGAC-3¢KU1010 5¢-CCCTTTAAAGGGAAACGCGCTTTGTTCTTTTCTTCTTCCTTTATCGATGAATTCGAGCTCG-3¢KU1011...
- 12
- 458
- 0
Báo cáo khoa học: Functional characterization of front-end desaturases from trypanosomatids depicts the first polyunsaturated fatty acid biosynthetic pathway from a parasitic protozoan ppt
... desaturated by a D4 desaturase to the same final 22:5 n-6 and 22:6 n-3 PUFAs.Euglena exhibits another variation in the first steps of the pathway. C18 FAs are elongated to C20, andthen a D8 desaturase ... cruzi (EAN90580), Euglena gracilis(AAQ19605), Isochrysis galbana (AAV33631), Pavlova lutheri(AAQ98793), Thraustochytrium sp. (AAN75710), Thalassiosira pseu-donana (AAX14506); D5 desaturases from ... that includes D5desaturase from Thraustochytrium sp., D4 desaturase from I. galbana and the O. tauri D6 acyl-CoA desatu-rase [19].Lastly, D6 desaturase from L. major was found inanother major...
- 10
- 476
- 0
Báo cáo khóa học: Structural properties of the protein SV-IV potx
... by the massincrease of 42 mass units. The relative level of acetylation of a peptide was estimated on the basis of the intensity ratio of the native and acetylated species. From the data summar-ized ... of the structural organization of SV-IV protein. The amino-acid sequence was analyzed using the BLASTprogram to find similar proteins in the ÔnrÕ database(nonredundant database consisting of all ... Structural properties of the protein SV-IVCarlo Caporale1, Carla Caruso1, Giovanni Colonna2,3, Angelo Facchiano4, Pasquale Ferranti4,5,Gianfranco Mamone4, Gianluca Picariello4, Flavia...
- 9
- 416
- 0
Từ khóa: Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXBT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ