Functional effects of deleting the coiled-coil motif in Escherichia coli elongation factor Ts Henrik Karring 1 , Asgeir Bjo¨ rnsson 2 , Søren Thirup 1 , Brian F. C. Clark 1 and Charlotte R. Knudsen 1 1 Department of Molecular Biology, Aarhus University, Denmark; 2 deCODE Genetics, Inc., Reykjavik, Iceland Elongation factor Ts (EF-Ts) is the guanine nucleotide- exchange factor for elongation factor Tu (EF-Tu) that is responsible for promoting the binding of aminoacyl- tRNA to the mRNA-programmed ribosome. The struc- ture of the Escherichia coli EF-Tu–EF-Ts complex reveals a protruding antiparallel coiled-coil motif in EF-Ts, which is responsible for the dimerization of EF-Ts in the crystal. In this study, the sequence encoding the coiled-coil motif in EF-Ts was deleted from the genome in Escherichia coli by gene replacement. The growth rate of the resulting mutant strain was 70–95% of that of the wild-type strain, depending on the growth conditions used. The mutant strain sensed amino acid starvation and synthesized the nucleotides guanosine 5¢-diphosphate 3¢-diphosphate and guanosine 5¢-triphosphate 3¢-diphosphate at a lower cell density than the wild-type strain. Deletion of the coiled-coil motif only partially reduced the ability of EF-Ts to stimulate the guanine nucleotide exchange in EF-Tu. However, the concentration of guanine nucleo- tides (GDP and GTP) required to dissociate the mutant EF-Tu–EF-Ts complex was at least two orders of mag- nitude lower than that for the wild-type complex. The results show that the coiled-coil motif plays a significant role in the ability of EF-Ts to compete with guanine nucleotides for the binding to EF-Tu. The present results also indicate that the deletion alters the competition bet- ween EF-Ts and kirromycin for the binding to EF-Tu. Keywords: elongation factor Ts; elongation factor Tu; guanine nucleotide exchange; kirromycin; (p)ppGpp. Elongation factor Tu (EF-Tu) and elongation factor Ts (EF-Ts) are proteins known from the classical model of the elongation cycle of protein synthesis in prokaryotes. EF-Tu, which is a highly conserved G-protein, is active in the GTP- bound form (EF-Tu–GTP) and inactive in the GDP-bound form (EF-Tu–GDP). The equilibrium dissociation con- stants for EF-Tu–GDP and EF-Tu–GTP are 1 · 10 )9 and 5 · 10 )8 M , respectively [1]. The active EF-Tu–GTP binds aminoacyl-tRNA (aa-tRNA) and promotes the binding of the aa-tRNA to the A-site of the mRNA-programmed ribosome. Upon codon recognition by a cognate ternary complex (EF-Tu–GTP–aa-tRNA), the ribosomal GTPase centre stimulates the GTPase activity of EF-Tu and the bound GTP is hydrolysed. The inactive EF-Tu–GDP is released from the ribosome and recycled to the active EF- Tu–GTP by the exchange of GDP with GTP [2]. Stimula- tion of the guanine nucleotide release in EF-Tu by EF-Ts [3] is required as the dissociation of GDP is otherwise very slow (2 · 10 )3 s )1 )[1,4].Invivo, the binding of GTP to the binary EF-Tu–EF-Ts complex is favoured owing to the ninefold higher concentration of GTP (0.9 m M ) than GDP (0.1 m M ) [5]. The activation of EF-Tu is completed by the dissociation of EF-Ts from EF-Tu–GTP. The equilibrium governing EF-Tu is further driven to the GTP-bound state by the formation of EF-Tu–GTP–aa-tRNA. Previous studies have indicated the existence of a structural isomerization in the EF-Tu–GDP–EF-Ts complex from a high- to a low-affinity nucleotide binding conformation [1,6,7]. According to the results published by Gromadski et al. [1], the structures of the binary EF-Tu–EF-Ts complex and the nucleotide- bound ternary complexes are different. EF-Ts in Escherichia coli is encoded by a single gene (tsf) located in the rpsB-tsf operon of the chromosome. The elongation factor consists of 282 residues and has a molecular mass of 30.3 kDa [8]. The structure of the E. coli EF-Tu–EF-Ts complex (Fig. 1) reveals that EF-Ts is an elongated molecule containing four domains: the N-ter- minal domain; the core domain; the dimerization domain; and the C-terminal module [9]. The dimerization domain (residues 180–228), which consists of a-helices 9, 10 and 11, is inserted in subdomain C of the core domain and contains the protruding antiparallel coiled-coil motif (helices 10 and 11, residues 187–203 and 208–226) responsible for the dimerization of EF-Ts in the crystal. In the crystal of E. coli EF-Tu–EF-Ts, a quaternary complex, formed by two molecules of each of the elongation factors, is observed. The coiled-coil motifs of each of the two EF-Ts molecules form strong intimate contacts with each other, and therefore thetetramerisbestdesignatedas[EF-Ts] 2 )2EF-Tu. However, the stoichiometry of the E. coli EF-Tu–EF-Ts Correspondence to C. R. Knudsen, Department of Molecular Biology, Aarhus University, Gustav Wieds Vej 10c, DK-8000 Aarhus C, Denmark. Fax: + 45 8612 3178, Tel.: + 45 8942 5036, E-mail: crk@imsb.au.dk Abbreviations: aa-tRNA, aminoacyl-tRNA; CBD, chitin binding domain; EF-G, elongation factor G; EF-Ts, elongation factor Ts; EF-Ts mt ,mitochondrialEF-Ts;EF-Tu,elongationfactorTu; LB, Luria–Bertani; MCS, multiple cloning site; ppGpp, guanosine 5¢-diphosphate 3¢-diphosphate; pppGpp, guanosine 5¢-triphosphate 3¢-diphosphate; (p)ppGpp, ppGpp and pppGpp. (Received 10 June 2003, revised 26 August 2003, accepted 8 September 2003) Eur. J. Biochem. 270, 4294–4305 (2003) Ó FEBS 2003 doi:10.1046/j.1432-1033.2003.03822.x complex used in the classical model of the elongation cycle has remained 1 : 1 because only the heterodimer has been detected in solution [10–12]. Thus, it is believed that dimerization of EF-Ts, as observed in the crystal structure, is not physiologically relevant. The cellular response to amino acid starvation causes an accumulation of the unusual guanine nucleotides guanosine 5¢-diphosphate 3¢-diphosphate (ppGpp) and guanosine 5¢-triphosphate 3¢-diphosphate (pppGpp) (stringent response) [13,14]. These compounds are synthesized by the relA gene product when activated by codon-specific A-site binding of uncharged tRNA, reflecting the limitation of the corresponding amino acid [15,16]. The guanosine 5¢-diphos- phate 3¢-diphosphate and guanosine 5¢-triphosphate 3¢-diphosphate [(p)ppGpp] nucleotides mediate a reduction in the elongation rate and influence the accuracy of translation. Early results indicated that (p)ppGpp affect translation by inhibition of elongation factors Tu, Ts and G [17–19]. However, more recent studies suggest that (p)ppGpp have no direct effects on either translation elongation or error rates, but rather effect translation indirectly by inhibition of mRNA synthesis during amino acid starvation [20–23]. Kirromycin is one in a family of antibiotics that inhibits protein synthesis by binding EF-Tu–GTP and preventing the release of EF-Tu–GDP from the ribosome [24]. These antibiotics bind at the interface between domain 1 (guanine nucleotide-binding domain, G-domain) and domain 3 of EF-Tu, and lock EF-Tu–GDP in the GTP-bound confor- mation after hydrolysis of the GTP at the ribosome [25]. Kirromycin has been shown to stimulate the nucleotide exchange in EF-Tu by increasing the dissociation of GDP and binding of GTP [26]. In addition, the binding of kirromycin and EF-Ts to EF-Tu are mutually exclusive [27]. Alignment of several EF-Ts sequences from different prokaryotes, as well as different eukaryotic organelles, shows preservation of the coiled-coil region (residues 187–226 in E. coli EF-Ts) only in prokaryotes and chloroplasts. The motif contains a number of well-conserved residues, such as Glu193, Lys206, Pro207, Lys213, Gly217 and Arg218 (E. coli numbering) of which most are located at the surface- exposed side of helix 11. In mammalian mitochondrial EF-Ts (EF-Ts mt , human and bovine) the region encompas- sing the coiled-coil motif is completely absent [28,29]. These observations suggest that the coiled-coil motif of EF-Ts has an important, but as yet unknown, role in bacteria. The role of the coiled-coil motif of EF-Ts in the guanine nucleotide-exchange reaction in EF-Tu was investigated by studying the functional effects of deleting the motif in EF-Ts, both in vivo and in vitro. The motif was deleted in endogenous EF-Ts in E. coli strain UY211 by gene replacement, and the phenotype of the resulting mutant strain (named GRd.tsf) was characterized. In addition, the activity of the coiled-coil deleted EF-Ts mutant in promoting guanine nucleotide exchange in EF-Tu, and the stability of the mutant EF-Tu–EF-Ts complex in the presence of guanine nucleotides and kirromycin, were examined in vitro. The present study shows that the coiled-coil motif in EF-Ts is not required for the guanine nucleotide-exchange Fig. 1. Structure of the Escherichia coli elongation factor Tu (EF-Tu)–elongation factor Ts (EF-Ts) heterodimer. EF-Ts is drawn as ribbons, indicating the secondary structure, whereas EF-Tu is drawn as a C-alpha trace. (A) The position of EF-Tu domains with respect to the N-terminal and core domains of EF-Ts. The structure shows that EF-Ts interacts with domain 1 (G-domain) and domain 3 of EF-Tu. (B) The view in (A) is rotated 90° around a vertical axis to show the positions of the protruding coiled-coil motif (residues 187–226) and the C-terminal module. The terminal positions of the deletion of the coiled-coil motif and the insertion of the linker peptide, EPGGEA, are indicated by residues Asp184 and Glu225, which are shown in Ôball & stickÕ representation. Coordinates were obtained from PDB entry [1EFU] and displayed using MOLMOL [64]. Ó FEBS 2003 Deletion of the coiled-coil motif of EF-Ts (Eur. J. Biochem. 270) 4295 reaction in EF-Tu. Instead, the motif plays a significant role in the ability of EF-Ts to compete with guanine nucleotides for the binding to EF-Tu. We propose that the coiled-coil motif in bacterial EF-Ts is involved in a structural isomerization step of the nucleotide-bound EF-Tu–EF-Ts complex during the guanine nucleotide-exchange reaction. Materials and methods Construction of gene replacement vector pMAK705-d.tsf A tsf mutant, lacking the sequence encoding the coiled-coil motif, was constructed by site-directed mutagenesis and inserted into the gene replacement vector, pMAK705 [30], for deletion of the motif in endogenous EF-Ts of E. coli. The exact terminal positions of the deletion in E. coli EF-Ts (residues 185–224) were decided upon by combining know- ledge about the structure of the coiled-coil motif (Fig. 1) with alignment analysis of E. coli EF-Ts and mammalian EF- Ts mt [28]. According to the structure of E. coli EF-Ts, deletion of this small, isolated domain should not have a major effect on the folding and stability of the remaining part of EF-Ts. However, the distance between EF-Ts residues Asp184 and Glu225 in the EF-Tu–EF-Ts complex was measured and found to be 12.2 A ˚ . Therefore, to bridge this gap in the resulting mutant, the hexapeptide EPGGEA, which is found at the corresponding position in mature bovine EF-Ts mt (residues 232–237) [31] and human EF-Ts mt (residues 243–248) [28], was inserted as alinker (Figs 1 and 2). Chromosomal DNA from E. coli strain UY211 (ara, D(lac-pro), nalA, thi) [32] was isolated and used as a template in two separate PCR reactions to prepare fragments flanking the sequence encoding the coiled-coil motif in EF-Ts. The fragments cover  200 base pairs of the genomic sequences upstream and downstream of tsf, respectively (Fig. 2), to ensure a satisfactory frequency of homologous recombination for the gene replacement. The upstream fragment was prepared using forward primer tsf- UPS (5¢-ATGCG GGATCCAAGCTTGAGCTTACATC AGTAAGTGACCGGGATGA-3¢) and reverse primer Ts185 (5¢-TAGCAC CCCGGGTTCGTCTTCCGGTTTG ATGAATTCTGGCTTG-3¢). Primer tsf-UPS contains a BamHI restriction site (underlined). Primer Ts185 contains a unique AvaI restriction site (underlined) and part of a sequence encoding the hexapeptide EPGGEA (bold text). The downstream fragment was prepared using forward primer Ts224 (5¢-TAGTTC CCCGGGGGTGAAGCTGA AGTTTCTCTGACCGGTCAGCCGTTC-3¢) and reverse primer tsf-DOWNS (5¢-AGTCA GGATCCGTCGACA GAGCTTCGCCACTCAACTTAAGCAGAA-3¢). Like primer Ts185, Ts224 contains a unique AvaI restriction site (underlined) and part of a sequence encoding the hexapep- tide EPGGEA (bold text). Primer tsf-DOWNS contains a BamHI restriction site (underlined). Both PCR products were digested with AvaI and ligated. The ligation was used directly as a template in a final PCR using primers tsf-UPS and tsf-DOWNS. Taq polymerase was used in all PCR amplifications. The amplified fragment containing the mutant tsf gene (d.tsf) was digested with BamHI and inserted into pMAK705. The sequence of the insert in the resulting pMAK705-d.tsf plasmid was verified by DNA sequencing. Deletion of the coiled-coil motif in endogenous E. coli EF-Ts E. coli strain UY211 was chosen for the gene replacement because of its almost wild-type genotype. Therefore, any unintended phenotypic side-effects of deleting the coiled-coil motif should not occur. The strain was transformed with pMAK705-d.tsf by electroporation, and selection for co- integrates and screening for regeneration of free plasmid was basically performed as described by Hamilton et al. [30]. Plasmids from single colonies were identified, following digestion with AvaI, as containing either wild-type or mutant tsf. Colonies carrying wild-type tsf on the pMAK705 vector were cured from the plasmid by sequen- tial inoculation and growth overnight three times in Luria– Bertani (LB) medium, without chloramphenicol, at 44 °C. The genomic deletion in colonies of the mutant strain (GRd.tsf) (Fig. 2) was verified by DNA sequencing. Measurement of growth rates A broad range of growth rates was obtained by culturing cells at 37 °C in various traditional and modified media based on LB, glucose/M9 or glucose/Mops [33,34]. The minimal media contained 0.40 m M proline and 1.0 m M thiamine to take into account auxotrophies. The concen- tration of glucose in the glucose/M9 and glucose/Mops media was 0.4% (w/v). For nutritional enrichments, the minimal media were supplemented with 0–3% (w/v) Casamino acid (Difco) or 0–3 times the recommended concentrations of L -amino acids and other nutrients, except Fig. 2. Schematic illustration of gene organizations in Escherichia coli strains and the gene replacement plasmid pMAK705-d.tsf. (A) Elonga- tion factor Ts (EF-Ts) wild-type strain UY211. (B) Gene replacement plasmid pMAK705-d.tsf, used for the deletion of the coiled-coil motif (cc) of endogenous EF-Ts. The plasmid contains an 1148-bp insert in which the region in E. coli tsf (bp 556–675) encoding the coiled-coil motif has been exchanged with a sequence encoding the hexapeptide EPGGEA found at the corresponding position in mammalian EF- Ts mt . (C) The coiled-coil deleted EF-Ts mutant strain GRd.tsf. Genes: rpsB, gene encoding ribosomal protein S2; tsf, gene encoding wild-type EF-Ts; cc, coiled-coil encoding region; smbA, gene encoding SmbA; d.tsf, gene encoding coiled-coil deleted EF-Ts mutant. Restriction site B: BamHI. 4296 H. Karring et al. (Eur. J. Biochem. 270) Ó FEBS 2003 for proline and thiamine [34]. LB medium was modified by replacing bacto-tryptone with various amounts of Casamino acid (1–3%). Overnight cultures were inoculated into 40 mL of media to a final attenuance D 600 of  0.1 or D 420 of  0.07. The D 600 culture was used to analyse growth in media based on LB, while the D 420 culture was used to analyse growth in the supplemented minimal media. Growth was followed by measuring D-values every 10–20 min. Data obtained from the exponential growth phase after at least one population doubling (D t >2· D 0 ) were used to determine the rate constant, l, according to the exponential growth equation [D t ¼ D 0 · exp(l · t)] [35]. Only growth curves with a correlation coefficient of R > 0.99 were accepted. Growth in the presence of kirromycin (Sigma) was performed at 37 °C in microtitre trays. LB medium (120 lL), containing kirromycin at the concentrations indicated, was inoculated with an overnight culture to a D 595 of  0.07. During growth, the D 595 was measured every 20–30 min by the use of an ELISA reader. For each concentration of kirromycin, three independent growth curves were recorded. Amino acid starvation and measurement of (p)ppGpp levels Cells from overnight cultures were washed in glucose/Mops and inoculated at a D 420 of  0.14 in 25 mL of glucose/Mops that contained  15 lCiÆmL )1 of [ 32 P]phosphate and 40 l M of proline, which represents 0.1 · the recommended amino acid concentration [34]. Cells were grown at 37 °Candthe cell density was followed by measuring the D 420 . Cell samples of 50 lL were withdrawn at appropriate time-points and mixedwith50lLof2.0 M formic acid. The labelled cell samples were run on TLC sheets [poly(ethylenimine)] and developed as described by Cashel et al. [36] with the only exception that 10 lL of the cell-free supernatant was spotted on the thin layer sheets. (p)ppGpp levels were determined by phosphor-imaging. Every (p)ppGpp measurement was nor- malized to the cell density by division with the D 420 of the culture at the corresponding time-point. To correct for the additional phosphate group in pppGpp compared with ppGpp, the ppGpp levels were multiplied by a factor of 1.25, in accordance with previous results [36]. The level of pppGpp in UY211 before starvation was given a value of 1.0. The dependency of growth inhibition on proline concentration was determined by growing cells in glucose/Mops containing different concentrations (20–60 l M )ofproline. Cloning of EF-Ts and construction of the EF-Ts mutant Wild-type E. coli EF-Ts was cloned into expression plasmid pAB146 (constructed by A. Bjo ¨ rnsson, unpublished results), which is a derivative of plasmid pET11d that contains the EcoRI–PstI Intein chitin binding domain (CBD) fragment of plasmid pCYB3 from the IMPACT System (New England Biolabs) [37]. In contrast to pCYB3, which contains one SapI restriction site, the multiple cloning site (MCS) of pAB146 contains two SapI restriction sites. The SapI sites (underlined) in the MCS (AAGAAGG A GCTCTTCCATGGAATTCCTCGAGGGCTCTTCC TGC) of pAB146 are designed for cloning of genes so that no additional amino acids are introduced into the final protein product. Plasmid pGEX-tsf [38] was used as template in a PCR. The applied primers both contain a SapI restriction site. In addition to the SapI restriction sites located in the primers, the E. coli tsf has an internal SapI restriction site. After digestion of the PCR product with SapI, the resulting two fragments were inserted into pAB146 in a three-fragment ligation. The cloning was verified by DNA sequencing. The resulting plasmid pAB146-tsf was used as a template in PCR amplifications for the construction of the coiled-coil deleted E. coli EF-Ts gene (d.tsf). The mutagenesis was basically performed as described for the construction of pMAK705-d.tsf, except that primers tsf-UPS and tsf- DOWNS were replaced with the plasmid-specific forward primer pT711 (5¢-TAATACGACTCACTATAGGGGA ATTG-3¢) and reverse primer Int R (5¢-CCCATGACCT TATTACCAACCTC-3¢), respectively. The final amplified fragment was digested with XbaI and KpnI and inserted into pAB146. The unique XbaI and KpnI restriction sites are positioned immediately upstream and downstream of the MCS of pAB146, respectively. The mutagenesis resulting in the construct pAB146-d.tsf was verified by DNA sequen- cing. Cloned Pfu polymerase (New England Biolabs) was used in all PCR amplifications. Expression and purification of E. coli EF-Tu and EF-Ts Expression and purification of E. coli EF-Tu using plasmid pGEXFXtufA was performed essentially as previously described [39]. Strain B834(DE3) (Novagen) was trans- formed with pAB146-tsf and pAB146-d.tsf for the expres- sion and purification of wild-type and mutant EF-Ts, respectively. LB medium containing 100 mgÆL )1 of ampi- cillin was inoculated with 1% of an overnight culture and incubated at 37 °C until a D 600 of 0.7 was reached. Expression was induced at 30 °C for 3 h by adding 0.5 m M of isopropyl thio-b- D -galactoside. Cells were har- vested by centrifugation and resuspended in Column Buffer (20 m M Tris/HCl, pH 8.0, 0.5 M NaCl, 0.1 m M EDTA, 10 m M MgCl 2 ,1.0gÆL )1 Triton-X-100, 15 l M GDP, 10% glycerol) to a final density of 0.25 gÆml )1 of cells. Clarified cell extract was prepared by passing the cell slurry twice through a French Press followed by centrifugation at 12 000 g for 20 min. The lysate was treated with DNase I and loaded onto a chitin column (New England Biolabs), equilibrated with Column Buffer, at 4 °C. The chitin column was thoroughly washed with Column Buffer and thereafter equilibrated with Precleavage Buffer (20 m M Tris/ HCl, pH 8.0, 50 m M NaCl, 0.1 m M EDTA). Then, the column was incubated at 25 °C for 16–24 h after fast equilibration with Cleavage buffer (Precleavage buffer containing 60 m M dithiothreitol). Pure EF-Ts was eluted with Elution Buffer (20 m M Tris/HCl, pH 8.0, 0.5 M NaCl, 0.1 m M EDTA, 1.0 gÆL )1 Triton-X-100) at 4 °Cand dialysed against 20 m M Tris/HCl, pH 7.2, 40 m M KCl, 1m M MgCl 2 ,0.1m M EDTA, 1 m M dithiothreitol, 20% glycerol. The concentration of EF-Ts was determined by amino acid analysis [40]. The EF-Tu–EF-Ts complex was formed by mixing equal amounts of EF-Tu and EF-Ts followed by dialysis in Buffer D(20m M Tris/HCl, pH 7.6, 50 m M KCl, 5 m M EDTA, Ó FEBS 2003 Deletion of the coiled-coil motif of EF-Ts (Eur. J. Biochem. 270) 4297 1m M dithiothreitol). This dialysis leads to the dissociation of Mg 2+ and GDP. The EF-Tu–EF-Ts complex was purified on a 5-mL HiTrap Q column (Pharmacia) using a 100-mL 100–375 m M KCl gradient in 20 m M Tris/HCl, pH 7.6, 1 m M dithiothreitol. The design of fusion proteins and the methods used for purification ensured that the recombinant proteins have the same number of amino acids as the native elongation factors. Activity assays The concentration of EF-Tu active in binding guanine nucleotides, and the activity of EF-Ts in promoting the exchange of guanine nucleotide with E. coli EF-Tu–GDP, was determined essentially as described previously [41], except that cellulose acetate filters (Gelman Sciences) were used for filter-binding. EF-Tu was  50% active in guanine nucleotide binding. Both wild-type and mutant EF-Ts were estimated to be 100% active based on their ability to bind EF-Tu, as judged by purification of the EF-Tu–EF-Ts complex in excess of EF-Tu by anion-exchange chromato- graphy, as described above. The ability of EF-Ts to stimulate the exchange of EF-Tu-bound GDP with free [ 3 H]GDP was determined at 0 °C. The reaction mixtures contained about 0.35 l M active EF-Tu, 2.5 l M [ 3 H]GDP ( 1100 c.p.m. per pmol) and different concentrations of EF-Ts (0–1.0 n M ), as indicated. The reactions were initiated by adding [ 3 H]GDP, and 100-lL samples were withdrawn every minute and filtered immediately. The filters were washed three times with 3 mL of cold Wash buffer (10 m M Tris/HCl, pH 7.6, 10 m M NH 4 Cl, 10 m M MgCl 2 )and dissolved in OptiPhase ÔHiSafeÕ 3 (Fisher Chemicals) before counting in a scintillation counter. The slope (pmol exchanged GDP min )1 ) from each exchange reaction was plotted as function of the added amount of EF-Ts. The slope of the GDP exchange in the absence of EF-Ts was subtracted from each slope value. The exchange of EF-Tu- bound GDP with free [ 3 H]GTP was performed as described for [ 3 H]GDP, except that pyruvate kinase and phos- phoenolpyruvate were included in the [ 3 H]GTP stock, so that the final concentrations in the assay were 16.5 lgÆmL )1 and 12 l M , respectively. The ability of EF-Ts to stimulate EF-Tu in translation in vitro was determined by poly(U)-directed polymerization of phenylalanine in the polymix system, as described by Ehrenberg et al. [42] and modified by Pedersen et al. [43]. Reaction mixtures were systematically titrated with E. coli wild-type EF-Ts, yeast [ 14 C]Phe-tRNA Phe , and ribosomes, to ensure that the nucleotide exchange limited the transla- tion. For the final experiments, the ribosome mix con- tained 2.0 l M 70S ribosomes and 2.6 mgÆmL )1 poly(U). The factor mix contained 8.0 l M [ 14 C]Phe-tRNA Phe (44 c.p.m. per pmol), 112 n M active EF-G, 40 n M active EF-Tu and 0–8.0 n M EF-Ts. The ribosome mix and the factor mix were incubated separately at 37 °C for 10 min before the reaction was initiated by mixing 25 lL of each. Every 5 min, an 8 lL sample was withdrawn for measurement of phenylalanine polymerization. Data were handled, as described above for the nucleotide exchange reactions. The 70S ribosomes were prepared from E. coli MRE600 cells, essentially as described by Spedding [44]. Yeast tRNA Phe was aminoacylated and extracted as described previously [43]. Zone-interference gel electrophoresis The stability of the E. coli EF-Tu–EF-Ts in the presence of guanine nucleotides and kirromycin was studied using the method of vertical zone-interference gel electrophoresis [45]. Agarose gels (1.5% and 2.0%), prepared in electrophoresis buffer (20 m M Tris acetate, pH 7.6, 3.5 m M magnesium acetate) were used in the experiments. Zone solutions containing guanine nucleotide and kirromycin, at the concentrations indicated, were prepared in electrophoresis buffer containing 5% (v/v) glycerol. Sample solutions were prepared in 10% (w/v) sucrose containing a trace of bromphenol blue. Zone solutions of 80 lL, and sample solutions of 5 lL, which contained 50 pmol of the EF-Tu– EF-Ts complex, were pipetted into slots. The electropho- resis was performed at 8 °C for 1 h at a constant voltage of 300 V, and the gel was stained as previously described [45]. Results Deletion of the coiled-coil motif in endogenous EF-Ts The sequence encoding the coiled-coil motif in tsf was deleted by gene replacement in E. coli strain UY211, using plasmid pMAK705-d.tsf (Fig. 2). The frequency of co-integrates in the gene replacement procedure was in the range of 10 )5 to 10 )4 . After regenerating free plasmid in the cells, colonies with deletion of the genomic sequence encoding the coiled-coil motif of EF-Ts were identified among the colonies harbouring free plasmid containing wild-type tsf. The deletion into the chromosome was verified directly by isolation of genomic DNA followed by PCR amplification and sequencing of the inserted DNA. The morphology of the resulting mutant strain (GRd.tsf) was compared with that of UY211 using a light microscope (cells not shown). No obvious differences in the size and shape of cells of GRd.tsf and UY211 were observed. Growth rates Growth rate constants (h )1 ) were determined from growth at 37 °C in a range of traditional and modified media based on LB medium, glucose/M9 or glucose/Mops. In all of the media tested, the growth rate of GRd.tsf was lower than that of UY211 (Fig. 3). The reduction in the growth rate of GRd.tsf compared with the growth rate of UY211 was more pronounced in media based on LB than in supple- mented minimal media. Therefore, the growth rates obtained in LB-based media could not be grouped with those obtained in supplemented minimal media. The maximal growth rate of UY211 was  1.6 and 1.85 h )1 in the groups of supplemented minimal media and that of media based on LB, respectively. For strain GRd.tsf, the maximal growth rate was 1.3 h )1 in both groups of media. Therefore, the growth rate of GRd.tsf ranges from  70– 95% of that of UY211 (Fig. 3). The lowest growth rate of GRd.tsf (70%), relative to the growth rate of UY211, was obtained in LB medium where both strains expressed their maximal growth rate. The absence of the coiled-coil motif does not affect growth at rates below 0.8 h )1 . In contrast, the mutant strain seems to be impaired in media supporting higher growth rates. This disadvantage caused by deletion 4298 H. Karring et al. (Eur. J. Biochem. 270) Ó FEBS 2003 of the coiled-coil motif is dependent on growth rate, i.e. the higher the potential growth rate (above 0.8 h )1 ), the larger the impairment. Phenotype during amino acid starvation The phenotypes of UY211 and GRd.tsf during amino acid starvation were determined by culturing cells at 37 °C in glucose/Mops containing growth-limiting amounts of proline (auxotrophic amino acid) (Fig. 4). Instantaneous growth inhibition caused by proline exhaustion was observed in both cases. However, strain GRd.tsf was found to be more sensitive to the depletion of proline than the wild-type strain. Proline exhaustion caused growth inhibition of GRd.tsf at a significantly lower cell density compared with UY211 (Fig. 4A). Thus, the point of growth inhibition of GRd.tsf (D 420 ¼ 0.47), represented by the D 420 value of the culture at the interception point between the exponential and the Ôstarvation phaseÕ of growth, is 78% of the point of growth inhibition of UY211 (D 420 ¼ 0.60). The point of growth inhibition of GRd.tsf when expressed as a percentage of that of UY211, was independent of the initial proline concentra- tion used (data not shown). In comparison, the mutant and the wild-type strains reached the same cell density in the stationary phase in both supplemented minimal media and in LB (data not shown). The synthesis of (p)ppGpp was measured (Fig. 4B) to determine if the Ôstarvation sensitiveÕ phenotype of GRd.tsf was the result of abnormal levels of (p)ppGpp. During exponential growth, the (p)ppGpp basal levels were similar in both stains (UY211 D 420 < 0.575; GRd.tsf: D 420 < 0.475). At the points of growth inhibition, ppGpp and pppGpp appear both in UY211 and GRd.tsf owing to the auxotrophic exhaustion of proline (Fig. 4A,B). After rapid increases to maxima, the levels of (p)ppGpp decrease to plateaus, which are maintained. No significant differences were observed between the levels and the production patterns of the (p)ppGpp in the two strains, either before or during the full stringent response (Fig. 4B). Growth rates in the presence of kirromycin The effect of kirromycin on the growth of GRd.tsf was investigated by measuring growth rates of cultures in LB containing various concentrations of kirromycin. During growth in microtitre trays, where aeration is suboptimal, strains UY211 and GRd.tsf had similar growth rates ( 0.85 h )1 ) in the absence of kirromycin. The growth rates of both strains decreased as the concentration of kirromycin was increased from 0.5 to 5.0 l M . However, the reduction in the growth rate caused by the presence of kirromycin was larger for strain GRd.tsf than for the wild- type strain (Fig. 5). Thus, at 50 l M kirromycin, the growth rate of GRd.tsf, as a percentage of the corresponding growth rate of the wild-type strain ( 0.32 h )1 ), was only 55%. Fig. 3. Growth rates. Diagram showing the growth rate of strain GRd.tsf as a function of the growth rate of the wild-type strain UY211. Each point represents a specific medium either based on Luria–Bertani (LB) medium (j) or supplemented minimal medium (h). Fig. 4. Amino acid starvation and guanosine 5¢-diphosphate 3¢-diphosphate (ppGpp) and guanosine 5¢-triphosphate 3¢-diphosphate (pppGpp) [(p)ppGpp] levels. (A) Growth curves of Escherichia coli UY211 (s)andGRd.tsf(j) in glucose/Mops initially containing 40 l M of proline. (B) (p)ppGpp levels in cultures of UY211 (ppGpp, s; pppGpp, d) and GRd.tsf (ppGpp, h; pppGpp, j) during proline exhaustion presented in relation to the attenuance D 420 of the cultures shown in (A). The levels of (p)ppGpp were normalized to cell densities and are presented relative to the level of pppGpp in UY211 before starvation, giving this level a value of 1. Ó FEBS 2003 Deletion of the coiled-coil motif of EF-Ts (Eur. J. Biochem. 270) 4299 Guanine nucleotide exchange and poly(U)-directed poly(Phe) synthesis The ability of the deletion mutant of EF-Ts to stimulate the activity of EF-Tu was tested in guanine nucleotide exchange and poly(U)-directed poly(Phe) synthesis assays (Fig. 6). The activity of the mutant EF-Ts in promoting the exchange of EF-Tu-bound GDP with free [ 3 H]GDP was 8.5 pmol exchanged GDP/(min · pmol EF-Ts) and, thus,  75% of the activity of the wild-type EF-Ts [11.1 pmol exchanged GDP/(min · pmol EF-Ts)] (Fig. 6A). When the nucleotide exchange activity was measured using [ 3 H]GTP instead of [ 3 H]GDP, the activity of the deletion mutant of EF-Ts was  65% of the activity of the wild-type EF-Ts (data not shown). However, the deletion mutant of EF-Ts was as active as the wild-type EF-Ts in promoting poly(U)-directed poly(Phe) synthesis with EF-Tu under the conditions used (Fig. 6B). The activity in the translation assay was 6.2 pmol [ 14 C]Phe incorporated/(min · pmol EF-Ts) for both EF-Ts species. Dissociation of the EF-Tu–EF-Ts complex by guanine nucleotides and kirromycin The stability of the mutant EF-Tu–EF-Ts complex in the presence of guanine nucleotides and kirromycin was analysed using zone-interference gel electrophoresis (Fig. 7). The principle of zone-interference gel electro- phoresis, described by Abrahams et al. [45], was used for the analysis to ensure that the concentrations of ligands were maintained at a constant level during migration of the elongation factors, thereby favouring equilibrium conditions. The concentration of guanine nucleotides required to dissociate the mutant EF-Tu–EF-Ts complex was at least two orders of magnitude lower than that for the wild-type complex. While the wild-type EF-Tu–EF-Ts complex remained stable at 1 m M GDP (Fig. 7A, lane 8), the mutant complex dissociated at 10 l M GDP (Fig. 7A, lane 14). When the experiment was repeated with GTP instead of GDP, the wild-type EF-Tu–EF-Ts complex remained stable at 10 m M GTP (Fig. 7B, lane 7), while the mutant complex dissociated at 0.1 m M GTP (Fig. 7B, lane 11). Unfortunately, concentrations of guanine nucleo- tides higher than 10 m M caused band smears, which made it impossible to detect dissociation of the wild-type EF-Tu–EF-Ts complex. The stability of the mutant EF-Tu–EF-Ts complex, in the presence of kirromycin, was examined at 10 l M GTP or 1 l M GDP, as these concentrations did not cause any dissociation of either the wild-type or the mutant EF-Tu– EF-Ts complex in the absence of kirromycin (Fig. 7B,A, respectively). In the presence of 5 l M kirromycin, the wild- type complex dissociated (Fig. 7C, lane 10), while a small, but reproducible, bandshift was observed with the mutant complex (Fig. 7C, lane 15). The bandshift was thought not to be related to dissociation, as this very dense band migrated faster than any of the individual components (compare lanes 3, 4, 6 and 15 in Fig. 7C). When the experiment was repeated with 1 l M GDP (Fig. 7D), instead of 10 l M GTP, the wild- type complex still dissociated at 5 l M kirromycin (Fig. 7D, lane 8), while the mutant complex appeared to dissociate at Fig. 5. Growth in the presence of kirromycin. The growth rate of strain GRd.tsf is presented as a percentage of the corresponding growth rate of the wild-type strain, UY211, in the presence of kirromycin. Fig. 6. Stimulation of the activities of elongation factor Tu (EF-Tu) by the coiled-coil deleted elongation factor Ts (EF-Ts) mutant. (A) Stimulation of the exchange of EF-Tu-bound GDP with free [ 3 H]GDP by wild-type EF-Ts (s) and the coiled-coil deleted EF-Ts mutant (j). (B) Stimulation of the activity of EF-Tu in poly(U)-directed poly(Phe) synthesis by wild-type EF-Ts (s) and the coiled-coil deleted EF-Ts mutant (j). The nucleotide exchange assays were repeated at least five times and the poly(Phe) assay was repeated six times. Each point in the figure represents a slope obtained from a time curve containing six measurements. The data shown are representative of the results obtained on each occasion. 4300 H. Karring et al. (Eur. J. Biochem. 270) Ó FEBS 2003 50 l M kirromycin (Fig. 7D, lane 18). In this experiment, no bandshift was observed. Discussion Phenotype of E. coli mutant GRd.tsf The results presented in Fig. 3 show that the functional activity of the coiled-coil motif of EF-Ts does not limit growth at growth rates below 0.8 h )1 . However, in media supporting higher growth rates, the mutant strain appears to be impaired in a proportional and medium-dependent manner over all growth rates. This result is somewhat surprising because growth conditions studied often consist of ÔrestrictedÕ media, in which the concentration of growth substrates is limited, rather than investigating the ability of cells to take up and utilize an unlimited concentration of growth substrates. The molar ratio of EF-Tu to ribosomes, as well as to EF-Ts, is known to decrease as the growth rate increases. In contrast, the ratio of EF-Ts to ribosomes is maintained at  1 : 1, irrespective of the growth rate [46–48]. Therefore, it is reasonable to assume that an increase in the growth rate and, thus, in the rate of protein synthesis, requires a faster recycling of EF-Tu. Hence, the concentration of EF-Tu–GDP probably increases with an increase in growth rate, and thereby the requirement for EF- Ts activity will also increase. Based on this assumption, the present results indicate that the maximal rate of the mutant EF-Ts in protein synthesis in vivo is  70%ofthatofthe wild-type EF-Ts. The studies of the effect of the EF-Ts mutation under starvation conditions suggest that the growth inhibition of GRd.tsf at a low cell density is caused by the binding of a deacylated tRNA to the ribosome rather than by a change in the synthesis of (p)ppGpp. Deacylated tRNA has a high codon-specific affinity for the ribosomal A site [49]. A moderate decrease in the level of active EF-Tu– GTP, owing to a less efficient EF-Ts, could cause ribosomal binding of deacylated tRNA and thereby (p)ppGpp synthesis at a lower cell density. This is in accordance with the view of Glazier et al. [50], who monitored the synthesis of (p)ppGpp in the temperature- sensitive EF-Ts mutant strain, HAK88, of E. coli. There- fore, the present results indicate that the deletion of the coiled-coil motif in EF-Ts probably reduces the formation of EF-Tu–GTP–aa-tRNA owing to a decrease in the regeneration of EF-Tu–GTP. A complete deletion of the tsf gene in bacteria has, to our knowledge, never been reported. In comparison, deletion of the single-copy gene, TEF5, in yeast, which encodes the Fig. 7. Analysis of the elongation factor Tu (EF-Tu)–elongation factor Ts (EF-Ts) complex in the presence of guanine nucleotides and kirromycin by zone-interference gel electrophoresis. (A) Wild-type and mutant EF-Tu–EF-Ts complexes in the presence of different concentrations of GDP (0–1.0 m M ). (B) Wild-type and mutant EF-Tu–EF-Ts complexes in the presence of different concentrations of GTP (0–10 m M ). (C) Wild-type and mutant EF-Tu–EF-Ts complexes in the presence of 10 l M GTP and different concentrations of kirromycin (0–50 l M ). The bandshift described in the text is indicated by a star. (D) Wild-type and mutant EF-Tu–EF-Ts complexes in the presence of 1 l M GDP and different concentrations of kirromycin (0–50 l M ). Sample solutions contained 50 pmol EF-Tu–EF-Ts complex. Ó FEBS 2003 Deletion of the coiled-coil motif of EF-Ts (Eur. J. Biochem. 270) 4301 guanine nucleotide-exchange factor (eEF1Ba) correspond- ing to EF-Ts, is lethal [51]. Thus, the observed growth reduction of up to 70% for the mutant EF-Ts in this study probably relates specifically to the deletion of the coiled-coil motif. We predict that also deletion of the tsf gene would be lethal. Guanine-nucleotide exchange activity The ability of EF-Ts to promote the guanine nucleotide exchange in EF-Tu was reduced by the deletion of the coiled- coil motif. This result supports the view that the lower growth rate of strain GRd.tsf, and its earlier synthesis of (p)ppGpp during amino acid exhaustion, are caused by a reduction in the rate of guanine nucleotide exchange. However, even though much effort was put into optimi- zing the poly(U)-directed poly(Phe) synthesis assay to ensure that the guanine nucleotide exchange in EF-Tu limited the polymerization, no effect of deleting the coiled-coil motif in EF-Ts was detected in this assay. Thus, the polymerization assay appeared to be less sensitive than the guanine nucleotide-exchange assay, as previously reported [52]. Stability of the EF-Tu–EF-Ts complex in the presence of guanine nucleotides The stability of the mutant EF-Tu–EF-Ts complex in the presence of guanine nucleotides was examined by the use of zone-interference gel electrophoresis (Fig. 7A,B). The fact that the concentration of guanine nucleotides required to dissociate the mutant complex was at least two orders of magnitude lower than for the wild-type complex shows that the deletion of the coiled-coil motif shifts the equilibrium in the guanine nucleotide-exchange reaction towards dissoci- ation of the EF-Tu–EF-Ts complex. This result suggests that the reduced activity of the mutant EF-Ts in guanine nucleotide exchange is caused by a reduction in the ability to compete with guanine nucleotides for the binding to EF-Tu. Previous mutational studies of E. coli EF-Ts, concerning residues directly involved in the binding of EF-Tu, have indicated a strong correlation between the abilities of the mutated forms of EF-Ts to compete with GDP for binding to EF-Tu and their activities in promoting guanine nucleo- tide exchange [53]. In contrast, the present results indicate that deletion of the coiled-coil motif in EF-Ts, which is not in contact with EF-Tu in the EF-Tu–EF-Ts complex (Fig. 1), strongly reduces the ability of EF-Ts to compete with GDP as well as GTP for binding to EF-Tu. Moreover, the activity in promoting guanine nucleotide exchange is only slightly reduced. Stability of the EF-Tu–EF-Ts complex in the presence of kirromycin The growth of GRd.tsf in the presence of kirromycin was examined because the binding of kirromycin and EF-Ts to EF-Tu has been shown to be mutually exclusive [27]. In the presence of less than 0.5 l M kirromycininthemedium, strain GRd.tsf was unaffected, while at concentrations higher than 0.5 l M kirromycin, the growth rate of GRd.tsf was reduced to a greater degree than that of the wild-type strain. This suggests that the competition between kirro- mycin and EF-Ts for the binding of EF-Tu is altered by deletion of the coiled-coil motif. Examination of the EF-Tu–EF-Ts complex by zone- interference gel electrophoresis in the presence of kirromycin supported that the mutant EF-Ts has an altered ability to compete with kirromycin for the binding of EF-Tu. In the presence of 10 l M GTP and 5 l M kirromycin, the mutant EF-Tu–EF-Ts complex had a slightly higher mobility than the mutant EF-Ts, the mutant EF-Tu–EF-Ts complex in the absence of kirromycin, and also the EF-Tu–GTP– kirromycin complex. Therefore, the observed bandshift cannot be explained by dissociation of the mutant EF-Tu– EF-Ts complex. This could indicate that a higher-order complex containing kirromycin might have been formed. The mobility shift of the mutant complex occurs at the same concentration of kirromycin (5 l M ) required to dissociate the wild-type complex. It is reasonable to expect that kirromycin will bind wild-type EF-Tu at the same concen- tration in both experiments. Therefore, we suggest that the shifted complex of the mutant EF-Tu–EF-Ts is EF-Tu– GTP–kirromycin–EF-Ts. The observed moderate increase in mobility of the complex in the presence of GTP and kirromycin is in accordance with what would be expected by the binding of a small (794 Da) and weakly acidic ligand, such as kirromycin [54,55], assuming that the binding of kirromycin to the mutant EF-Tu–EF-Ts complex does not induce large conformational changes. Stabilization of the mutant EF-Tu–EF-Ts complex by the binding of kirromycin would reduce the pool of EF-Tu and EF-Ts available for protein synthesis in the cell. This could explain the additional reduction in the growth rate of GRd.tsf compared with that of the wild-type strain in the presence of the antibiotic. The formation of a quaternary complex would probably require a conformational change in the EF-Tu–EF-Ts complex, as the binding site of kirromycin is not present in the EF-Tu–EF-Ts structure. In addition, the structure of the wild-type EF-Tu–EF-Ts complex [9], and that of the complex between EF-Tu–GDP and aurodox (methyl kirromycin) [25], show that the binding sites of EF-Ts and kirromycin on EF-Tu are not overlapping. Thus, the suggested binding of kirromycin to the mutant EF-Tu–EF-Ts complex either indicates that the conformation of EF-Tu in the mutant complex is different from that of the wild-type complex, or that the mutant complex is more flexible than the wild-type complex, which might facilitate the binding of the antibiotic. Comparison of mutant EF-Ts and EF-Ts from bovine mitochondria Elongation factors equivalent to the prokaryotic EF-Tu and EF-Ts are active during protein synthesis in mitochondria and chloroplasts. The coiled-coil motif is preserved in prokaryotes and chloroplasts, but absent in mammalian mitochondria. Therefore, it was of interest to compare the activities of mutant EF-Ts and EF-Ts mt . However, such a comparison should be undertaken bearing in mind the many differences between the two EF-Ts species. EF-Ts mt is only 29% identical to E. coli EF-Ts. Furthermore, EF-Ts mt has an 11-residue C-terminal extension, 21 residues inserted between helices 5 and 6, and 12 residues inserted between b-strands 4 and 5, compared with E. coli EF-Ts. 4302 H. Karring et al. (Eur. J. Biochem. 270) Ó FEBS 2003 Unlike the EF-Tu–EF-Ts complex from E. coli,the corresponding mitochondrial complex is not easily disso- ciated by nucleotides [56]. When EF-Ts mt is expressed in E. coli, it forms a heterologous complex with the endo- genous EF-Tu, which is 100-fold stronger than the homologous E. coli complex. The heterologous complex has been found to be active in poly(U)-directed protein synthesis [57,58]. It is mainly the region in EF-Ts mt , corresponding to subdomain N in the core domain of E. coli EF-Ts, that appears to be responsible for the strong complex formation with E. coli EF-Tu [58,59]. Our studies have shown that the coiled-coil motif also plays a central role in controlling the stability of the EF-Tu–EF- Ts complex. In contrast to the enhancing effect of the mitochondrial subdomain N on the strength of a hetero- logous EF-Tu–EF-Ts complex, the effect of making the E. coli EF-Ts more mitochondrial-like by deleting the coiled-coil region is a dramatic weakening of the complex. Therefore, one would expect that an EF-Ts chimera between the N-terminal half of EF-Ts mt and the C-terminal half of E. coli EF-Tu should form an even stronger complex with E. coli EF-Tu. This turns out to be the case, as shown previously by Zhang et al. [58]. Previous studies have shown that mutations in EF-Ts mt , which cause a weakening in the interaction with E. coli EF-Tu, correlate with an increased ability to stimulate GDP exchange as well as an increased activity in polymerization [53,58]. The authors suggest that the strong interaction between EF-Ts mt and E. coli EF-Tu makes it difficult for guanine nucleotides to compete for interaction with EF-Tu, thereby reducing the stimulatory effect of EF-Ts. Therefore, the effect observed was probably caused by a shift in the equilibrium governing the exchange reaction. We did not observe a similar correlation in our studies, as both the strength of the EF-Tu–EF-Ts complex, as well as the stimulatory effect on guanine nucleotide exchange, was decreased by deletion of the coiled-coil motif. This might indicate that the coiled-coil motif is directly involved in guanine nucleotide exchange. The role of the coiled-coil motif The results of the present study demonstrate that the coiled-coil motif in E. coli EF-Ts is not crucial for the stimulatory effect of EF-Ts on the guanine nucleo- tide exchange in EF-Tu, even though the stability of the EF-Tu–EF-Ts complex in the presence of guanine nucleotide is dramatically reduced. Although the coiled- coil motif is not strictly required for survival, it confers a strong selective advantage to a cell; this explains its preservation during evolution. In support of this, the coiled-coil motif has apparently been lost from the mitochondria after its origin as an aerobic bacterium that established residency within the cytoplasm of a primitive eukaryote (according to the endosymbiotic theory) [60]. In this manner, the eukaryotic partner was supplied with energy in exchange for a stable, protected environment, and a readily available supply of nutrients. In a milieu such as this, the ingested bacterium would have no advantage for preserving the coiled-coil motif. Previous studies of E. coli EF-Ts derivatives [52,53], in combination with the present results, suggest that the most essential regions for the activity of EF-Ts are located in the N-terminal domain and the core domain. These observa- tions are compatible with the absence of both the coiled-coil motif and the C-terminal module in mammalian EF-Ts mt , which can bind E. coli EF-Tu and stimulate the activity of this elongation factor [31,57]. The present results support the view that the E. coli EF-Tu–EF-Ts complex exists as a heterodimer, rather than as a heterotetramer in translation, and therefore indicate that the crystallographic dimerization of E. coli EF-Ts is only caused by the packing of the EF-Tu–EF-Ts complex in the crystals. In contrast to E. coli EF-Ts, the protruding antiparallel coiled-coil motif (helices 6 and 7) of Thermus thermophilus EF-Ts is not involved in any dimerization in the crystal structure of the EF-Tu–EF-Ts complex [28]. However, the dimerization of the coiled-coil motifs in the E. coli EF-Tu–EF-Ts crystals suggests an affinity of the coiled-coil motif for an unidentified helical structure. In this regard, the present results could indicate that such a helical structure interacts with the coiled-coil motif during a conformational change in one step of the nucleotide exchange reaction and somehow stabilizes the EF-Tu–EF-Ts complex in the presence of guanine nucleotides. Pressure relaxation studies of the nucleotide exchange reaction have indicated that the ternary complex, EF-Tu– thioGDP–EF-Ts, undergoes an isomerization step [7]. Likewise, Gromadski et al. [1] have proposed that the binary complex, EF-Tu–EF-Ts, and the ternary complexes containing EF-Tu, EF-Ts and GDP/GTP, are structurally different. Inspection of the structure of E. coli EF-Tu– EF-Ts suggests that the N-terminal domain of EF-Ts, which consists of helical structures, might be a good candidate as an interaction partner for the coiled-coil motif. The N-terminal domain appears to be highly mobile and disordered in free EF-Ts [28], and is separated from the core domain by a highly accessible region [38]. Based on the present results, we propose that the preserved antiparallel coiled-coil motif in bacterial EF-Ts is involved in a protein– protein interaction within the EF-Ts molecule during an isomerization step of the nucleotide-bound EF-Tu–EF-Ts complex. Two-stranded antiparallel coiled-coil motifs are known to be involved in either protein–protein interactions [61,62] or protein–RNA interactions [63]. The proposed intramolecular interaction may be an integrated step in the guanine nucleotide-exchange mechanism. Acknowledgements We would like to thank Karen Margrethe Nielsen and Lene Kristensen for technical help and Drs Gregers Rom Andersen and Jens Nyborg for valuable discussions and ideas. Financial support from the Program for Biotechnological Research of the Danish Natural Science Research Council is gratefully acknowledged. References 1. Gromadski, K.B., Wieden, H.J. & Rodnina, M.V. (2002) Kinetic mechanism of elongation factor Ts-catalyzed nucleotide exchange in elongation factor Tu. Biochemistry 41, 162–169. 2. Krab, I.M. & Parmeggiani, A. (1998) EF-Tu, a GTPase odyssey. Biochim. Biophys. Acta 1443, 1–22. Ó FEBS 2003 Deletion of the coiled-coil motif of EF-Ts (Eur. J. Biochem. 270) 4303 [...]... crystallization of a 25 kDa C-terminal fragment of cloned elongation factor Ts from Escherichia coli FEBS Lett 368, 49–54 Ó FEBS 2003 Deletion of the coiled-coil motif of EF -Ts (Eur J Biochem 270) 4305 39 Knudsen, C.R., Clark, B.F., Degn, B & Wiborg, O (1992) Onestep purification of E coli elongation factor Tu Biochem Int 28, 353–362 40 Sottrup-Jensen, L (1993) Determination of halfcystine in proteins as cysteine... (1989) Bovine mitochondrial protein synthesis elongation factors Identification and initial characterization of an elongation factor Tu -elongation factor Ts complex J Biol Chem 264, 19125–19131 Xin, H., Leanza, K & Spremulli, L.L (1997) Expression of bovine mitochondrial elongation factor Ts in Escherichia coli and characterization of the heterologous complex formed with prokaryotic elongation factor Tu... Antalik, M., Podhradsky, D & Sprinzl, M (1998) Dimers of Thermus thermophilus elongation factor Ts are required for its function as a nucleotide exchange factor of elongation factor Tu Eur J Biochem 255, 81–86 12 Miller, D.L & Weissbach, H (1977) Factors involved in the transfer of aminoacyl-tRNA to the ribosome In Molecular Mechanisms of Protein Biosynthesis (Weissbach, H & Petska, S., eds), pp 323–373... Zhang, Y., Sun, V & Spremulli, L.L (1997) Role of domains in Escherichia coli and mammalian mitochondrial elongation factor Ts in the interaction with elongation factor Tu J Biol Chem 272, 21956–21963 Zhang, Y & Spremulli, L.L (1998) Roles of residues in mammalian mitochondrial elongation factor Ts in the interaction with mitochondrial and bacterial elongation factor Tu J Biol Chem 273, 28142–28148 Gray,... studying weak protein– nucleic acid complexes under native equilibrium conditions Nucleic Acids Res 16, 10099–10108 46 Gordon, J & Weissbach, H (1970) Immunochemical distinction between the Escherichia coli polypeptide chain elongation factors Tu and Ts Biochemistry 9, 4233–4236 47 Gordon, J (1970) Regulation of the in vivo synthesis of the polypeptide chain elongation factors in Escherichia coli Biochemistry... pyrimidines In Escherichia coli and Salmonella typhimurium (Neidhardt, F.C., ed.), pp 445–473 American Society for Microbiology, Washington, D.C 6 Eccleston, J.F (1984) A kinetic analysis of the interaction of elongation factor Tu with guanosine nucleotides and elongation factor Ts J Biol Chem 259, 12997–13003 7 Eccleston, J.F., Kanagasabai, T.F & Geeves, M.A (1988) The kinetic mechanism of the release of. .. Spremulli, L.L (1998) Mutational analysis of the roles of residues in Escherichia coli elongation factor Ts in the interaction with elongation factor Tu J Biol Chem 273, 4556–4562 Wolf, H & Zahner, H (1972) Metabolic products of microorganisms 99 Kirromycin Arch Mikrobiol 83, 147–154 Vos, C & Verwiel, P.E.J (1973) The total structure of the novel antibiotic mocimycin (MYC 8003) Tetrahedron Lett 14, 5173–... Chinali, G., Wolf, H & Parmeggiani, A (1977) Effect of kirromycin on elongation factor Tu Location of the catalytic center for ribosome -elongation- factor- Tu GTPase activity on the elongation factor Eur J Biochem 75, 55–65 28 Wang, Y., Jiang, Y., Meyering-Voss, M., Sprinzl, M & Sigler, P.B (1997) Crystal structure of the EF-Tu–EF -Ts complex from Thermus thermophilus Nat Struct Biol 4, 650–656 29 Karring,... Conformational change of elongation factor Tu (EF-Tu) induced by antibiotic binding Crystal structure of the complex between EF-Tu, GDP and aurodox J Biol Chem 276, 17149–17155 26 Fasano, O., Bruns, W., Crechet, J.B., Sander, G & Parmeggiani, A (1978) Modification of elongation- factor- Tu–guanine-nucleotide interaction by kirromycin A comparison with the effect of aminoacyl-tRNA and elongation factor Ts Eur J Biochem... (1975) Content of elongation factor Tu in Escherichia coli Proc Natl Acad Sci USA 72, 4780–4784 49 Levin, J.G (1970) Codon-specific binding of deacylated transfer ribonucleic acid to ribosomes J Biol Chem 245, 3195–3202 50 Glazier, K & Schlessinger, D (1974) Magic spot metabolism in an Escherichia coli mutant temperature sensitive in elongation factor Ts J Bacteriol 117, 1195–1200 51 Kinzy, T.G & Woolford, . the functional effects of deleting the motif in EF -Ts, both in vivo and in vitro. The motif was deleted in endogenous EF -Ts in E. coli strain UY211 by gene replacement,. assumption, the present results indicate that the maximal rate of the mutant EF -Ts in protein synthesis in vivo is  70%ofthatofthe wild-type EF -Ts. The studies of