0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: Metal exchange in metallothioneins – a novel structurally significant Cd5 species in the alpha domain of human metallothionein 1a ppt

Báo cáo khoa học: Metal exchange in metallothioneins – a novel structurally significant Cd5 species in the alpha domain of human metallothionein 1a ppt

Báo cáo khoa học: Metal exchange in metallothioneins a novel structurally significant Cd5 species in the alpha domain of human metallothionein 1a ppt

... ª 2008 The Authors Journal compilation ª 2008 FEBS 2239 Metal exchange in metallothioneins a novel structurally significant Cd5 species in the alpha domain of human metallothionein 1a Kelly ... encompasses the metal- binding cysteinesbetween Cys33 and Cys60 of the a domain of native human metallothionein 1a but also includes aminoacids not found in the native protein. The four diva-lent ... 37 5–3 78.18 Stillman MJ, Cai W & Zelazowski AJ (1987) Cadmiumbinding to metallothioneins. Domain specificity in reac-tions of a and b fragments, apometallothionein, andzinc metallothionein...
  • 13
  • 438
  • 0
Tài liệu Báo cáo khoa học: Fish and molluscan metallothioneins A structural and functional comparison ppt

Tài liệu Báo cáo khoa học: Fish and molluscan metallothioneins A structural and functional comparison ppt

... do-main and cadmium in the a domain. Therefore, the b domain would regulate zinc and copper homeostasis,whereas the a domain may play a central role in heavy metal detoxification [7]. The loosely ... 12 3–1 34.40 Pan PK, Hou FY, Cody CW & Huang PC (1994) Sub-stitution of glutamic acids for the conserved lysines in the alpha domain affects metal binding in both the alpha and beta domains ... weaker metal thiolate interaction because of the reduced num-ber of lysines. In fact, substitution of three lysines withglutamates in the CK motifs of the a domain modified the metal- binding ability...
  • 10
  • 414
  • 0
Báo cáo khoa học: Gc recruitment system incorporating a novel signal amplification circuit to screen transient protein-protein interactions pot

Báo cáo khoa học: Gc recruitment system incorporating a novel signal amplification circuit to screen transient protein-protein interactions pot

... were extracted, and the targetZI3 1A gene was amplified by PCR with primers 5¢-AAATATAAAACGCTAGCGTCGACATGGCGC-3¢ and 5¢-AGCGTAAAGGATGGGGAAAG-3¢. The final ratio of targetcells was determined by ... amount of target strain(BFG2Z18-I3 1A; ZI3 1A –Fc) and an excess amount of nontarget strain (BFG2118; None–Fc). As in the cur-rent system, the other contained a minor amount of sig-nal-amplifiable ... in yeast. J Biochem 147, 87 5–8 84.20 Togawa S, Ishii J, Ishikura A, Tanaka T, Ogino C &Kondo A (2010) Importance of asparagine residues atpositions 13 and 26 on the amino-terminal domain...
  • 9
  • 536
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Exploring Deterministic Constraints: From a Constrained English POS Tagger to an Efficient ILP Solution to Chinese Word Segmentation" ppt

... accuracy is badly hurt. In contrast,when searching in a constrained space rather than the raw space, the constrained tagger (beam=5) is 10times fast as the baseline and the tagging accuracyis even ... compute the morph feature of a word as the set of all of its possible tags, i.e.all tag types that are assigned to the word in trainingdata. Furthermore, we approximate unknown words in testing data ... taggingConsidering the ambiguity problem that a Chinesecharacter may appear in any relative position in a word and the out -of- vocabulary (OOV) problem thatit is impossible to observe all words in training...
  • 9
  • 425
  • 0
Báo cáo khoa học: G protein-coupled receptor 30 down-regulates cofactor expression and interferes with the transcriptional activity of glucocorticoid pdf

Báo cáo khoa học: G protein-coupled receptor 30 down-regulates cofactor expression and interferes with the transcriptional activity of glucocorticoid pdf

... is independent of the differ-entiation status (normal vs. c ancer) of the epithelial c ells in the mammary gland.We also show here that the abolition of hormone-mediated transactivation of a ... Primer pair 1 resulted in a PCR product of 216 bp. Additionally, forward primer5¢-GAGCCCC AAGAAGAAAGA-3¢ and reverse primer5¢- CATCCAAAATCTCC TCCA-3¢ were used. Primer pair2 resulted in a PCR ... Liquid Scintillation Counter(Wallac). Equal transfection efficiency was confirmed bymeasuring b-galactosidase activity in heat-treated (10 m in at 50 °C)lysatesasrecommendedintheb-GalactosidaseEnzyme...
  • 10
  • 389
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Fast Semantic Extraction Using a Novel Neural Network Architecture" docx

... aid of a parser or a chun-ker. Our resulting system obtains accuraciescomparable to the current state -of -the- art at a fraction of the computational cost.1 IntroductionSemantic understanding ... whilstinteractive human- machine applications require al-most instant response. Another issue is the cost of producing labeled training data required for statisti-cal models, which is exacerbated ... of these tasks are end goals in themselves but can be seen as layers of feature ex-traction that can help in a language-based end ap-plication, such as the ones described above. Un-fortunately,...
  • 8
  • 302
  • 0
Báo cáo khoa học: Transcription factor specificity protein 1 (SP1) and activating protein 2a (AP-2a) regulate expression of human KCTD10 gene by binding to proximal region of promoter pot

Báo cáo khoa học: Transcription factor specificity protein 1 (SP1) and activating protein 2a (AP-2a) regulate expression of human KCTD10 gene by binding to proximal region of promoter pot

... TTGCGGTTTAGGTACATCCAKCTD10RP TGTGGCTCTGTGGAACATTTSp1FP GGACTACCTGGAGTGATGCCTAASp1RP CCCATCAACGGTCTGGAACTAP-2aFP CAACGTTACCCTGCTCACATCA Real-time PCRAP- 2a RP CAGGTCGGTGAACTCTTTGCAb-actinFP GCGCGGCTACAGCTTCAb-actinRP ... ChIPAP- 2a ⁄ chipR GAAAAGTCGGAGGACG ChIPSp1 ⁄ chipF GGACTACCTGGAGTGATGCCTAA ChIPSp1 ⁄ chipR CCCATCAACGGTCTGGAACT ChIPAP- 2a ⁄ si GCUCCACCUCGAAGUACAATT RNAiSp1 ⁄ si NNAGCGCUUCAUGAGGAGUGA RNAiKCTD10FP ... factor alpha- induced protein 1(TNFAIP1), respectively. Like PDIP1 and TNFAIP1,KCTD10 protein also contains a BTB ⁄ POZ domain and a potassium channel tetramerization (K-tetra) domain (a relative...
  • 11
  • 409
  • 0
Tài liệu Báo cáo khoa học: Octaketide-producing type III polyketide synthase from Hypericum perforatum is expressed in dark glands accumulating hypericins pdf

Tài liệu Báo cáo khoa học: Octaketide-producing type III polyketide synthase from Hypericum perforatum is expressed in dark glands accumulating hypericins pdf

... present in the petal margins, whereas the nod-ules in the interior parts of the petals are elongatedtubulars [10,12]. In this study, nodules in both the margins and the interior parts of the petals ... accumulation of hypericins, indicating that HpPKS2 may have a role in the initial key reaction step in the biosynthesis of hypericins in H. perforatum. However, although the enzyme is capable of carrying ... His-Tagged Proteins. QIAGEN Inc., Valencia, CA.47 Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of proteinutilizing the principle of protein–dye binding....
  • 14
  • 451
  • 0
Tài liệu Báo cáo khoa học: Cytochrome P450 Cyp4x1 is a major P450 protein in mouse brain doc

Tài liệu Báo cáo khoa học: Cytochrome P450 Cyp4x1 is a major P450 protein in mouse brain doc

... mid-way along the chain.Northern blot analysis showed high level expression of the CYP4x1 RNA in brain and in aorta, and thiswas confirmed by analysis of the EST database; thisshowed significant ... RNA for RNAase protection assay. M indicates the 124-basepair marker transcript (M), the full-length probe is indicated by a line, and the protected fragment is indicated by an arrow. The RNAase ... binding, the antisera were preincubatedwith purified recombinant Cyp4x1 protein, resulting in the ablation of detection of the 55-kDa protein in brain(Fig. 5C). This shows that the antisera specificallydetect...
  • 12
  • 466
  • 0
Báo cáo khoa học: Transmembrane helix 12 plays a pivotal role in coupling energy provision and drug binding in ABCB1 pot

Báo cáo khoa học: Transmembrane helix 12 plays a pivotal role in coupling energy provision and drug binding in ABCB1 pot

... indicate thatTM12 plays a key role in the progression of the ATP hydrolytic cycle in ABCB1 and, in particular, in coordinating conformational changes between the NBDs and transmembrane domains.AbbreviationsABC, ... interface.There was no alteration in the extent of labelling byBM in any conformational state examined. In contrast,there was a dramatic reduction in labelling by the hydrophilic FM as the protein ... labelling intensity observed with the single-cysteine-containing isoforms. Obtaining fulllabelling and its accurate quantitation are difficult toachieve in practice, resulting in occasional instanceswhere...
  • 12
  • 380
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Chuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)