0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: Structural and mutational analysis of TenA protein (HP1287) from the Helicobacter pylori thiamin salvage pathway – evidence of a different substrate specificity doc

Báo cáo khoa học: Structural and mutational analysis of TenA protein (HP1287) from the Helicobacter pylori thiamin salvage pathway – evidence of a different substrate specificity doc

Báo cáo khoa học: Structural and mutational analysis of TenA protein (HP1287) from the Helicobacter pylori thiamin salvage pathway evidence of a different substrate specificity doc

... Structural and mutational analysis of TenA protein (HP1287) from the Helicobacter pylori thiamin salvage pathway evidence of a different substrate specificity Nicola Barison1,2, Laura Cendron1,2, ... (Stratagene, La Jolla, CA,USA). The primers used were: 5¢-TATATCATTCAGGATTATTTGTATCTTTTAGAATACGCTAAGGTG-3¢ (forward, the mutagenesis codon underlined) and 5¢-TTAGCGTATTCTAAAAGATACAAATAATCCTGAATGATATAAAAAC-3¢ ... has been identifiedas the starting point of the thiamin salvage pathway inB. halodurans [3], apparently cannot play the same rolein H. pylori because the amidohydrolase enzyme YlmBis also absent.In...
  • 9
  • 491
  • 0
Báo cáo khoa học: Structural and functional analysis of the interaction of the AAA-peroxins Pex1p and Pex6p pptx

Báo cáo khoa học: Structural and functional analysis of the interaction of the AAA-peroxins Pex1p and Pex6p pptx

... N-terminal region (N, aa 1–4 00), the firstAAA-cassette (D1, aa39 4–6 81) and the second AAA-cassette (D2, aa66 9–1 043). DNA fragments encodingthese parts of Pex1p were fused to the GAL4-AD and coexpressed ... studies of these AAA-peroxins and give a further detailed functional analysis of their cassettestructure and interaction. The interaction of Pex1p and Pex6p involvestheir first AAA-cassettes ... 47functions and proteolysis [17,18]. AAA-proteins share the presence of one or two AAA-cassettes, comprisingabout 230 amino acids and are characterized by Wal-kerA and B motifs for ATP-binding and ATP-hydro-lysis...
  • 12
  • 584
  • 0
Báo cáo khoa học: Structural and mutational analyses of protein–protein interactions between transthyretin and retinol-binding protein doc

Báo cáo khoa học: Structural and mutational analyses of protein–protein interactions between transthyretin and retinol-binding protein doc

... a- helix and the C-terminal b-strand of RBP and the hyper-variable regions of Fab: loops 5 3–5 6 and 10 0–1 03 and the short helix 2 8–3 2 of chain H and loops 3 1–3 6 and 5 3–5 6 of chain L. The interactions,which ... almostsolvent exposed, in the region of the loops that con-nect b-strands A and B, C and D and E and F and surround the entrance of the b-barrel at the openend of the cavity. As a result of ... Waltham, MA, USA).Crystallization, data collection, structuredetermination and refinement for the TTR–RBP–Fab complex and the V20S and Y114 TTR variantsCrystallization and preliminary X-ray...
  • 14
  • 263
  • 0
Báo cáo khoa học: Structural and functional analysis of ataxin-2 and ataxin-3 potx

Báo cáo khoa học: Structural and functional analysis of ataxin-2 and ataxin-3 potx

... H atakeyama, S., Ishimoto, H.,Tanimura, T., Tsuji, S., Kakizuka, A. , Kitagawa, M. &Nakayama, K.I. (2004) Molecular clearance of ataxin-3 isregulated by a mammalian E4. EMBO J. 23, 65 9–6 69.132. ... Huntington disease ( HD), d entatorubral-pallidoluysian atrophy (DRPLA), and other spinocerebellarataxia t ypes such as SCA1, SCA7 and SCA 17 [ 3–7 ]. T he a ge of onset of SCA2 and SCA3 is in the third ... consist of two g lobular domains named Lsm(Like S m, amino acid 25 4–3 45) [37] and LsmAD (Lsm-associated doma in, amino acid 35 3–4 75). The LsmADdomain of ataxin-2 contains both a clathrin-mediatedtrans-Golgi...
  • 16
  • 526
  • 0
Báo cáo khoa học: Structural and functional roles for b-strand 7 in the a-crystallin domain of p26, a polydisperse small heat shock protein from Artemia franciscana pdf

Báo cáo khoa học: Structural and functional roles for b-strand 7 in the a-crystallin domain of p26, a polydisperse small heat shock protein from Artemia franciscana pdf

... 5¢-CACGTACAAAGAGAACGTCGACGACG-3¢5¢-CGTCGTCGACGTTCTCTTTGTACGTG-3¢R11 4A 5¢-GAGAATTTCGAGCACGATACAGACTCCC-3¢5¢-GGGAGTCTGTATCGTGCTCGAAATTCTC-3¢Y116D 5¢-CGACGACGAGACAGACTCCCAGAACATGTC-3¢5¢-GACATGTTCTGGGAGTCTGTCTCGTCGTCG-3¢Y. Sun et al. ... assense and antisense, respectively, for each mutation.p26mutation PrimerR110G 5¢-GGACACGTACAAGGAGAATTTCGACGACG-3¢5¢-CGTCGTCGAAATTCTCCTTGTACGTGTCC-3¢F112R 5¢-CACGTACAAAGAGAACGTCGACGACG-3¢5¢-CGTCGTCGACGTTCTCTTTGTACGTG-3¢R11 4A ... Chaperones 8, 38 1– 394.70 Rajaraman K, Raman B, Ramakrishna T & Rao CM(2001) Interaction of human recombinant aA- and aB-crystallins with early and late unfolding intermedi-ates of citrate...
  • 15
  • 515
  • 0
Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

... N2 of the base makes a hydrogen bond to a main chain car-bonyl. Binding of a xanthine base from XMP in the same position, would lead to the loss of a hydrogenbond and a less favorable interaction. ... PRTFDC1 proteins have lost their phosphoribosyl-transferase activity [10]. The structural characterization of numerous com-plexes of the human HPRT and several bacterial and protozoan HPRTs have ... residues from the C-terminus and consists of a two-stranded anti-parallel b-sheet composed of b2 and b9 and an a- helix from the C-terminus (Fig. 1A) . The two subunits in the asymmetric unit, together...
  • 11
  • 770
  • 0
Tài liệu Báo cáo khoa học: Structural and mechanistic aspects of flavoproteins: electron transfer through the nitric oxide synthase flavoprotein domain pdf

Tài liệu Báo cáo khoa học: Structural and mechanistic aspects of flavoproteins: electron transfer through the nitric oxide synthase flavoprotein domain pdf

... ligand [1 7–1 9,24]. The attachedflavoprotein and heme domains of NOS are also anunusual feature shared by only a handful of prokary-otic CYP proteins [4,8,25].In comparison, the NOS flavoprotein ... has fundamen-tal structural, thermodynamic and mechanistic featuresin common with the dual-flavin family of reductases,there are unique aspects related to NO synthesis thatconstrain and shape ... 50 and near 100%) [63,77]. At this point, the data suggestthat Keq A and the associated kon and koffconforma-tional rates are primary factors in regulating the cyto-chrome c reductase activity...
  • 16
  • 639
  • 0
Tài liệu Báo cáo khoa học: Structural and mechanistic aspects of flavoproteins: probes of hydrogen tunnelling pptx

Tài liệu Báo cáo khoa học: Structural and mechanistic aspects of flavoproteins: probes of hydrogen tunnelling pptx

... kJÆmol)1[9]. From the little experimental evidence cur-rently available, it appears that it is appropriate todescribe H-tunnelling reactions using Marcus theory, and that a general feature of these reactions ... reduction during the reaction of the wild-type (wt) and N18 9A mutant of MR withNADH. The wt trace is fit to a single exponential and the N18 9A trace to a 4-exponential function see the main text for ... substrate- binding titrations and crystallo-graphic studies when a very large amount of the sub-strate may be required; typical NAD(P)H saturationconstants for OYEs are 0.1-1 mm and as an example,a...
  • 12
  • 595
  • 0
Tài liệu Báo cáo khoa học: Structural and mechanistic aspects of flavoproteins: photosynthetic electron transfer from photosystem I to NADP+ doc

Tài liệu Báo cáo khoa học: Structural and mechanistic aspects of flavoproteins: photosynthetic electron transfer from photosystem I to NADP+ doc

... protein flavin complexes and tailor the midpoint potentials in these proteins, aswell as many details of the binding and electron transfer to protein and ligand partners, have been revealed. In addition ... M, Aoki S,Sato D, Kobayashi T, Kita K, Horii T & Hase T(2007) Cloning and characterization of ferredoxin and ferredoxin–NADP+reductase from human malariaparasite. J Biochem 141, 42 1–4 28.154 ... reductionpotentials and in the energetics of the FMN:apoproteininteraction in Anabaena flavodoxin. Biochemistry 43,1511 1–1 5121.27 Fukuyama K, Wakabayashi S, Matsubara H & RogersLJ (1990) Tertiary...
  • 17
  • 634
  • 0
Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

... (CATATGGCTAGCATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCGTGCCAACTCCCAC) containing a BamHI site. The genewas cloned at the NheI and BamHI sites of the ... also.Overall structural features of the protein St SurE is an aba sandwich protein and adopts the Rossmann fold as in archaic and thermophilic homo-logues. The St SurE monomer consists of 13 b-strands,six ... Katz JE, Beasley S, Khachatr-yan A, Vyas S, Arrowsmith CH, Clarke S, Edwards A, Joachimiak A et al. (2001) Structure of Thermotogamaritima stationary phase survival protein SurE: a novel acid...
  • 10
  • 553
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họccách làm báo cáo khoa họctrình bày báo cáo khoa họcNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ