Development of a simple
Development of a simple
... extraction procedure for SPM-associatedtrace metals, using a ligand competition approach with EDTA as the added complexing ligand. The use of EDTA allows thedetermination of available particulate ... been explained byan increase in major cation concentrations. Suspendedparticulate matter may consist of biological, organicand mineral phases [5] and each of these phases has a different af®nity ... using a HDPE scrap-per. Air was expelled and the bag was resealed andthen stored at 48C for transport to the laboratory. In thelaboratory, the particulate material was immediatelyair dried at...
- 15
- 410
- 0
Development of a method to measure consumer emotions associated with foods
... Thomson(2008) has also argued that concepts such as satisfaction are moreappropriate than simple acceptance for commercial products, andthat both brand and packaging need to be considered along withthe ... chocolate, vanilla ice cream, fried chicken and mashedpotatoes and gravy. Pizza and chocolate produced the strongestemotions based on Analysis of Variance. The terms active, adven-turous, affectionate, ... techniques which areappropriate for the academic laboratory research might not beappropriate for commercial settings of consumer laboratories. Aca-demic laboratory research typically uses student...
- 10
- 781
- 3
Development of a Regional Risk Management Framework for APEC Economies for use in the Control and Prevention of Introduced Marine Pests
... Marine PestsPriorities and hazards for Economies Variable levels of activity and management capabilityShips’ ballast water and hull fouling are the most important vectorsInternational ... vectorsInternational shipping, aquaculture and biodiversity are most threatened values Amount of commercial shipping and number of trading partners affecting pathway strength A limited number of ... strategic measuresManagement Framework - Introduced Marine PestsPhase 1 – Consultancy Identified current management capabilities and approaches Priorities and hazards for APEC EconomiesConsiderations...
- 10
- 583
- 0
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf
... 5¢-CTCGAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA-1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former,and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCAGGGG-3¢ for the latter. The ... isolation and long-termculture of organ-specific blood vascular and lymphaticendothelial cells of the mouseTakashi Yamaguchi, Taeko Ichise, Osamu Iwata, Akiko Hori, Tomomi Adachi, Masaru Nakamura,Nobuaki ... Ag-expressingendothelial cellpAloxP loxPpAtsA58TCAGtsA58TCAGEnzymatic digestion of organsCulture at 33 °CSerial passages every 2–3 daysat split ratio 1 : 3day 20–30day 0βgeoFig. 1. An endothelial...
- 11
- 873
- 0
Báo cáo " Development of a spectrometry system Using lock-in amplification technique " doc
... system we can now obtain weak optical signals, for example, Raman Spectra of Vietnam petrol extracts excited by not only an 2W Argon laser but also by a 30mW He-Ne laser. Key words: Raman spectroscopy, ... characters. A command to the SR830 consists of a four characters command mnemonic, arguments if necessary, and a command terminator. The SR830 has a 256 character input buffer and processes commands ... spectroscopy, Optical- Second Harmonic Spectroscopy, Surface SH generation. 1. Introduction Laser Raman spectroscopy including Raman Scattering, Resonance Raman Scattering, Stimulated Raman Scattering...
- 6
- 524
- 0
Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx
... (5¢-CGTCAAGGAGAAAAAACCCCGGATCTAAAAAATGGAGCAGAAACTCATCTCTGAAGAGGATCTG-3¢) and (5¢-GCATGCCTGCAGGTCGACTCTAGAGGATCTCAAGCCAGTGACCGCCTCCC-3¢); for Golf(5¢-GGTACCGCTGCAATGGGGTGTTTGGGCAAC-3¢) and ... (5¢-CGTCAAGGAGAAAAAACCCCGGATCTAAAA AATGGAGC AGAAA CTCATCTCTGAAGAGGATCTG -3¢) and (5¢- GCATGC CTGCAGGTCGACTCTAGAGGATCTCAAGCCAGTGACCGCCTCCC-3¢), and checked for the presence and sequence of thenew ... DNAse-treated RNA extracts. Primers used for RT-PCR were: forthe I7 OR (5¢-CGTCAAGGAGAAAAAACCCCGGATCTAAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AGCTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAATTTTGCTGCC-3¢);...
- 14
- 473
- 0
Báo cáo "Development of a software package for 3D structured mesh generation " pdf
... compressible atmospheric flows and air quality simulations. 4.1. The graphic user interface of the package The package is designed with a main interface that allows users to input topographical elevation ... 93-106 93 Development of a software package for 3D structured mesh generation Duong Ngoc Hai, Nguyen Tat Thang* Institute of Mechanics, Vietnam Academy of Science and Technology (VAST) Received ... topography, Proceedings of the 2005 Annual National Conference on Fluid Mechanics, (2005) 55 (in Vietnamese). [4] Duong Ngoc Hai (project manager), Development of a software for the simulation of...
- 14
- 402
- 0
Báo cáo khoa học: The antagonistic effect of hydroxyl radical on the development of a hypersensitive response in tobacco pot
... ABA had a higher OH•level after ParA1 treatment. H2O, H2Opretreatment; H + ParA1, ParA1 infiltration after H2O treatment; A4 00, 400 lM ABA pretreatment; A + ParA1, ParA1 infiltration after ... oligonucleotide prim-ers: 5¢-TGAATTCAATAATGTCTAACTTCCGCGCTCT-GTTC-3¢ and 5¢-AGGTACCTCAATGATGATGATGATGATGATGCAGTGACGCGCACGTAGA-3¢. For the suc-cessful protein expression, a yeast expression consensussequence ... plus adenine), PT (ParA1 plusthiourea), PV (ParA1 plus ascorbic acid) and PC(ParA1 plus catalase) were infiltrated into the sameleaves of tobacco plants, which had been sprayed with100 lm ABA,...
- 15
- 479
- 0
Từ khóa: development of a simple efficient and general method for cofactor recycling in a bio oxidationfurther development of a secured unifieddevelopment of a regional risk management framework for apec economies for use in the control and prevention of introduced marine pestsdevelopment of a spoken languagedesign of a simple machinedevelopment of a recipe management systemBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ