Báo cáo Y học: Two independent, light-sensing two-component systems in a filamentous cyanobacterium pot
Báo cáo Y học: Two independent, light-sensing two-component systems in a filamentous cyanobacterium pot
... cphA:forward,GCGATACCATGGTATCCGAATTCCAAG and reverse, ACCCGGGTCGACTCAGTGATGGTGGTGATGGTGTCCTCGACCAAAAAGATC; rcpA:forward,GCGATAGAATTCATGAGCGTAGAAACGGAAGAC and reverse, CGAAGCTTGTCGACTCAGTGATGGTGGTGATGGTGCTCCGACGGCAATGTCG; ... CGAAGCTTGTCGACTCAGTGATGGTGGTGATGGTGCTCCGACGGCAATGTCG; cphB:forward,GCGATAGAATTCATG ACGAATTGCGATCGCGA and reverse, ACCCGGGTCGACTCAGTGATGGTGGTGATGGTGTTTGACCTCCTGCAATGT; cphBlong:forward,GCGATAGAATTCATGTTGCAGTTAATTTATAACAATT; ... cphBlong:forward,GCGATAGAATTCATGTTGCAGTTAATTTATAACAATT; the reverseprimer was identical to that used for cphB; rcpB:forward,GAGGCTGAATTCATGGTAGGAAACGCTACTCAAC;reverse, CGAAGCTTGTCGACTCAGTGATGGTGGTGATGGTGACCCATCTCAGGAAGTACAAC.Ó...
- 10
- 499
- 0
Báo cáo y học: "Utility of routine chest radiographs in a medical–surgical intensive care unit: a quality assurance survey"
... quality assurance surveyNatalie Chahine-Malus, Thomas Stewart, Stephen E Lapinsky, Ted Marras, David Dancey, Richard Leung and Sangeeta MehtaMount Sinai Hospital, Toronto, Ontario, CanadaCorrespondence: ... beneficial to patient care. Brainsky et alobserved that 20% of routine CXRs performed in a medicalICU had ‘major important’ findings, and 8% prompted a change in management [4]. The majority of changes ... were anticipated by the clinical examination, andonly 3.4% of all routine CXRs presented findings not clinicallyanticipated. Conversely, several studies have concluded thatroutine CXRs are...
- 5
- 506
- 0
Báo cáo y học: " Non-syndromic multiple supernumerary teeth in a family unit with a normal karyotype: case report"
... “mesiodens”, anamnestically deter-mined a familial predisposition in 31% of cases6. Su-pernumerary teeth are frequently found in the supe-rior maxillary bone and mainly in the premaxilla (90-98%) ... and symptomatology. • Tumefaction on the vestibular or pala-tine/lingual area. Hyperdontia therapy depends on the area and on the number of teeth in excess (erupted into proper maxillary arch ... Surgery, University of Bari, Bari, Italy 2. Department of Medical Biochemistry, Medical Biology and Physics, University of Bari, Bari, Italy 3. Department of “Head and Neck Surgery”, Hospital “Fatebenefratelli”,...
- 7
- 597
- 0
Báo cáo y học: "Comparative study of control selection in a national population -based case-control study: Estimating risk of smoking on cancer deaths in Chinese men"
... in a large case-control study that was incorporated into a nationwide mortality survey in China in 1989–1991. As an example, we assessed the hazards of tobacco use on smoking-related cancer ... patterns in urban and rural areas was used as a surrogate analy-sis by socioeconomic status. In conclusion, the basic principles of equivalence are also supported by epidemiological survey data. ... indication. Our findings revealed that better equivalence exists in urban than in rural areas, and for cancers with a high death rate than for ‘rare’ cancers. The possible expla-nations may...
- 9
- 532
- 1
Báo cáo y học: "Replacement of cisplatin with nedaplatin in a definitive 5-fluorouracil/ cisplatin-based chemoradiotherapy in Japanese patients with esophageal squamous cell carcinoma"
... Japanese patients with esophageal squamous cell carcinoma Akiko Kuwahara 1, Motohiro Yamamori 2, Kohshi Nishiguchi 3,4, Tatsuya Okuno 3, Naoko Chayahara 3, Ikuya Miki 3, Takao Tamura 3, ... 3, Tsubasa Inokuma 2, Yoshiji Takemoto 2, Tsutomu Nakamura 3, Kazusaburo Kataoka 1 and Toshiyuki Sakaeda 2,3 1. School of Pharmacy and Pharmaceutical Sciences, Mukogawa Women’s ... © Ivyspring International Publisher. All rights reserved Research Paper Replacement of cisplatin with nedaplatin in a definitive 5-fluorouracil/ cisplatin-based chemoradiotherapy in Japanese...
- 7
- 531
- 0
Báo cáo y học: "Sustained High Quality of Life in a 5-Year Long Term Follow-up after Successful Ablation for Supra-Ventricular Tachycardia. Results from a large Retrospective Patient Cohort"
... AVNRT: Atrio-Ventricular Nodal Reentry Tachycardia; AVRT: Atrio-Ventricular Reentry Tachycardia; AF: Atrial Fibrillation; EAT: Ectopic Atrial Tachycardia; F: French; INR: International Normalized ... Quantity and duration of episodes and the associated symptoms. Panel B: Detraction in daily life generally and in parts of daily life. AVNRT AVRT EAT variable Value N % N % N % PANAL A ... and insufficient (6). Y- axis: Percentage of patients Panel A: AVNRT. Panel B: AVRT. Panel C: EAT Comparing the categorical variables before and after ablation in AVNRT patients, applying...
- 9
- 679
- 0
Báo cáo Y học: Balanced expression of single subunits in a multisubunit protein, achieved by cell fusion of individual transfectants docx
... done. Whereas SC is readilysecreted without assembly with the other components, this isnot the case for a1 heavy-chain and J-chain. Both areretained and degraded intracellularly unless in complex ... absorbance was read byTitertekÒ Multiskan (ICN Flow, USA). The amount ofIgA present in each supernatant was calculated relative to a standard preparation with known concentration.Verification ... the IgA and SClevels in all the clones demonstrated that a sufficient amountof J-chain was available for SIgA complex formation. OneSIgA-producing clone (SIgA-3) along with pIgA-D andIgA-29...
- 6
- 371
- 0
Báo cáo y học: "Two-year Outcome of Turkish Patients Treated with Zotarolimus Versus Paclitaxel Eluting Stents in an Unselected Population with Coronary Artery Disease in the Real World: A Prospective Non-randomized Registry in Southern Turk
... initial trials indicate that the ZES is safe and reduces the rates of clinical and angiographic restenosis in patients with symptomatic coronary ar-tery disease (CAD; 4). Also the safety and ... included major adverse cardiac events (MACE) at two year (MACE: Death, myocardial infarction, target vessel revascularization (TVR). Target vessel revasculariza-tion was defined as being either ... Abbreviations: CABG, coronary artery bypass graft; HDL, high-density lipoprotein; LDL, low-density lipoprotein; MI, myo-cardial infarction; SAP, stable angina pectoris; USAP, unstable angina...
- 6
- 550
- 0
Báo cáo y học: " Two-stage procedure in the treatment of late chronic hip infections spacer"
... infections. Infection was successfully eradicated in 100 patients (87.7%) at a mean follow-up of two years. Spacers Spacers are classified as static or non-articulating spacers, medullary dowels, and ... clinical presentation, the findings on physical examination and the interpretation of relevant inves-tigations. The treatment goals are to attempt limb salvage and preserve joint function in an ... migration of the dowel down the femoral canal and help facilitate removal. After insertion, a moulded arthrodesis block or an articulating spacer may be inserted. Disadvan-tages include the potential...
- 5
- 549
- 0
Báo cáo Y học: Two different E2F6 proteins generated by alternative splicing and internal translation initiation ppt
... 5¢-GGGAATTCTCAGATAGAGTCTTCTCTGGGAGC-3¢SG50: 5¢-GGGGACCAGGGTGACCGCGG-3¢SG92: 5¢-GCGCGGGAGATCTAACGGACGG-3¢SG108: 5¢-CCTCTAGACGCGCCGTCCGGTGCTGACTCAT-3¢SG109: 5¢-GGGGATCCATGCCATCAAAAATAAGGATTAAT-3¢SG142: ... points after serum addition.Synchronization was confirmed by FACS analysis.RNA isolationTotal RNA was isolated from primary MEFs with theRNeasy kit (Qiagen) according to the manufacturer’sinstructions. ... Two different E2F6 proteins generated by alternative splicingand internal translation initiationTillman Dahme1, Jason Wood1, David M. Livingston1and Stefan Gaubatz21Dana Farber Cancer...
- 7
- 323
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật