Báo cáo khoa học: "Does Size Matter – How Much Data is Required to Train a REG Algorithm?" potx

... Dutch data. The D-TUNA data are cleaner thanthe TUNA data (Theune et al., 2010), so the risk of“bad” training data will be smaller, which may lead to more consistent results across training ... differentfrom those obtained using a much larger trainingset. Domain complexity appears to be a factor in how much training data is needed: using Dice as anevaluation metric, training sets of 10 ... Netherlandss.wubben@uvt.nlAbstractIn this paper we investigate how much data is required to train an algorithm for attributeselection, a subtask of Referring ExpressionsGeneration (REG) . To enable...

Báo cáo khoa học: "DESIGNING ILLUSTRATED TEXTS: HOW LANGUAGE PRODUCTION IS INFLUENCED BY GRAPHICS GENERATION" pptx

... It is an important goal of this research not simply to merge the verbalization results of a natural language generator and the visualization results of a knowledge-based graphics generator, ... Stuhlsatzenhausweg 3, 6600 Saarbrficken 11, Germany E-mail: {wahlster, andre, graf, rist)@dfki.uni-sb.de ABSTRACT Multimodal interfaces combining, e.g., natural language and graphics take advantage ... the text and graphics generators. 2.2 THE LAYOUT MANAGER The main task of the layout manager is to convey certain semantic and pragmatic relations specified by the planner by the arrangement...

Báo cáo khoa học: Phosphorylation-dependent binding of human transcription factor MOK2 to lamin A⁄C pot

... thoseLexANH2FingerBaitPreyββ–Gal – pGAD–GHpLex–hsMOK2NH2LexAFinger – pLexALexApGAD–JLP ( 1–1 41)+ /– pGAD–GHpLex–NH2LexANH2 – pGAD–GHpLex–FingerLexAFinger+ /– pLex–NH2LexANH2pGAD–JLP ( 1–1 41)+++pLex–hsMOK2pGAD–JLP ... phosphory-lated and then released from lamin A ⁄ C. This regula-tion may take place following activation of kinasessuch as PKA in response to various signalingpathways. In addition, Aurora A kinase is ... p38MAPK signaling modules & transcriptionfactors. Proc Natl Acad Sci USA 99, 1418 9–1 4194.12 Ito M, Yoshioka K, Akechi M, Yamashita S, Takama-tsu N, Sugiyama K, Hibi M, Nakabeppu Y, Shiba...

Báo cáo khoa học: Multi-tasking of nonstructural gene products is required for bean yellow dwarf geminivirus transcriptional regulation potx

... wererepeated in triplicate.Northern blot analysisPlant total RNA was isolated by the method of Chomczyn-ski & Sacchi, and 10 lg of puriﬁed total RNA per lane wasloaded onto a 1% agarose denaturing ... of banana bunchy top virus DNA-1 to 6 in transgenic tobacco and banana cells. J Gen Virol79, 230 1–2 311.52 Huang Z, Andrianov VM, Han Y & Howell SH (2001)Identiﬁcation of arabidopsis proteins ... lmolÆmin)1(per mg of total protein).Luciferase from plasmid pLUC was included as an internalcontrol in this assay, and statistical analysis was performedaccording to Breyne et al. [55]. All GUS experiments...

Báo cáo khoa học: Combining theoretical analysis and experimental data generation reveals IRF9 as a crucial factor for accelerating interferon a-induced early antiviral signalling pdf

... interferon -a andinterferon-c through induced synthesis of one subunit ofthe transcription factor ISGF3. EMBO J 9, 110 5–1 111.10 Tamada Y, Nakao K, Nagayama Y, Nakata K,Ichikawa T, Kawamata Y, Ishikawa ... Nakao K, Nakata K, Yamashita M, Tamada Y,Hamasaki K, Ishikawa H, Kato Y, Eguchi K & Ishii N(1999) p48 (ISGF-3c) is involved in interferon -a- induced suppression of hepatitis B virus enhancer-1activity. ... (IFN) are important components of the innate antiviralresponse. A key signalling pathway activated by IFNa is the Janus kinase ⁄signal transducer and activator of transcription (JAK ⁄ STAT) pathway.Major...

Báo cáo khoa học: Activation of p21-activated kinase 1 is required for lysophosphatidic acid-induced focal adhesion kinase phosphorylation and cell motility in human melanoma A2058 cells potx

... PAK1 activity was accessed with MBPas a substrate after immunoprecipitation with an antibodyraised against PAK1. Activation of PAK1 by LPA wasmaximalat5minincubationwith7.8-foldincrease,andreturned ... clearlydemonstrated that PAK1 activation was required for FAKphosphorylation to increase cell motility by LPA in A2 058human melanoma cells.Activation of PAK is regulated intracellularly by variousfactors ... PAK1 activity was assessed byPAK immunocomplex MBP in-gel kinase assay, as described underMaterials and methods, and MBP phosphorylation was assessed byautoradiography. Data are presented as...

Tài liệu Báo cáo khoa học: Parvalbumin deficiency in fast-twitch muscles leads to increased ‘slow-twitch type’ mitochondria, but does not affect the expression of fiber specific proteins doc

... RT-PCRGAPDH GAG CTG AAC GGG AAG CTC ACT GG GTG AGG GAG ATG CTC AGT GTT GG 429 RT-PCRCaN AGTAACAATTTTCAGTGCTCCAAAC AATATACGGTTCATGGCAATACTGT 205 RT-PCRCaMKII CTACCCCGGCGCTGGAGTCAAC TCAGATGTTTTGCCACAAAGAGGTGCCTCCT ... Babraham Hall,Barbraham, Cambridge, UK) and CaN activity was meas-ured according to the manufacturer’s instructions. TotalCaN activity is expressed as a percentage vs. control ani-mals and ... us to analyze, in detail, mitochondrial alterations and to investigate the presence of additional putative com-pensation mechanisms in PV– ⁄ – fast-twitch muscles.Tibialis anterior (TA) was...

Báo cáo khoa học: Does different orientation of the methoxy groups of ubiquinone-10 in the reaction centre of Rhodobacter sphaeroides cause different binding at QA and QB? potx

... recombination kinetics at 865 nmafter photobleaching of the primary donor to a sum of twoexponentials: A ¼ A 1exp(–k1t1) +A 2exp(–k2t2). Uponnormalization of the amplitudes A 1(fast Q A – decay) ... vibrations mayalso contribute to these bands. However, the clear shiftsshow that the (ring-)C-O vibration is the dominating mode,as expected by normal mode analysis (M. Nonella,P. Tavan, ... reference to the personal communication to make clear that our conclusions are not only based on thepublished data [31], but also on the information commu-nicated by M. Nonella and P. Tavan which...

Báo cáo khoa học: "Circadian pattern of activation of the medical emergency team in a teaching hospita"

... medical emergencyresponses and teams. A traditional cardiac arrest ('code blue')team is comprised of a cardiology fellow and coronary carenurse, as well as an intensive care fellow and ... staff should be available on a 24-hour basis to assess and treat acutely ill hospital patients.Utilization of a MET system has been associated with a reduc-tion in all-cause hospital mortality ... hospital loudspeakers and paging system, and a detailed log of all calls is maintained.Criteria for medical emergency team activationCalling criteria for our MET service are based on acutechanges...

Tài liệu Báo cáo khoa học: An anthrax lethal factor mutant that is defective at causing pyroptosis retains proapoptotic activity pdf

... An anthrax lethal factor mutant that is defective atcausing pyroptosis retains proapoptotic activityStephanie Ngai, Sarah Batty, Kuo-Chieh Liao and Jeremy MogridgeDepartment of Laboratory ... sufﬁcient to induce apoptosis. It is unclear why the mutant is defec-tive at causing pyroptosis, but it is presumably becauseLF-K518E ⁄ E682G has a diminished capacity to cleave a substrate that is ... inducing vascular leakage that leads to shock and multiorgan failure [ 3–6 ]. The role ofLeTx in anthrax pathogenesis is complex, however,and probably involves the impairment of the innateand adaptive...

Xem thêm