Báo cáo khoa học: Unravelling the functional interaction structure of a cellular network from temporal slope information of experimental data docx

... 2005 FEBS 3959 Unravelling the functional interaction structure of a cellular network from temporal slope information of experimental data Kwang-Hyun Cho1,2, Sung-Young Shin3and Sang-Mok Choo31 ... suchtime-series experimental data containing (partially) cor-rect dynamic pattern changes then we can infer the (partial) interaction structure of the underlying cellular network by integrating the analysis ... the experimental data proﬁles.There have been diverse approaches to identify (orreverse engineer) the functional interaction structure of a cellular network from given experimental data. Theseinclude...

Tài liệu Báo cáo khoa học: Mapping the functional domains of human transcobalamin using monoclonal antibodies pptx

... maximalmAb ⁄ heparin effect on the functional activ-ity of TC. Arrows show the hypotheticalmovement of the domains after attachment of Cbl, see the main text.Mapping of transcobalamin using antibodies ... Geremia S &Randaccio L (2001) Crystallization and preliminaryX-ray diffraction analysis of human transcobalamin, a vitamin B12-transporting protein. Acta Crystallogr D57,1890–1892.16 Quadros ... recent data have shownthat Cbl assembles distant domains of IF in a morecompact structure with high afﬁnity to the ligand and the speciﬁc receptor [13,14]. One can hypothesize the same transformation...

Tài liệu Báo cáo khoa học: Mapping the functional domain of the prion protein docx

... GCCCCATGGCGGTGGATGGCATATGGGAGGGGGTACCCPrP105–231 GGAACAAGCCCAGCCATATGAAAACCAACCTCAAGCPrP113–231 CCAACCTCAAGCATATGGCAGGGPrPD35–45 GGGTGGAACACCGGTGGCAACCGTTACCCPrP112–119 CCTCAAGCATGTGGTAGTGGGGGGCCPrPD112–136 ... and deletion mutants indicate the relativeimportance of these domains to PrP’s SOD-like activity.Comparison of data presented in Tables 2 and 3indicates that there are principally two domains ... antibodies have been mapped and are listed inTable 2. The activity of wild-type PrP is like that of a SODand this activity can be measured by a number of assays. The most robust and accessible...

Báo cáo khoa học: Structural and functional analysis of the interaction of the AAA-peroxins Pex1p and Pex6p pptx

... studies of these AAA-peroxins and give a further detailed functional analysis of their cassette structure and interaction. The interaction of Pex1p and Pex6p involvestheir first AAA-cassettes ... comprising the N-terminal fragment and the first AAA-cassette of PEX6 (PEX6N + D1–GAL4-BD). Neither of the cas-settes alone nor the two AAA-cassettes together or the N-terminal part together with the ... N-terminal region (N, aa1–400), the firstAAA-cassette (D1, aa394–681) and the second AAA-cassette (D2, aa669–1043). DNA fragments encodingthese parts of Pex1p were fused to the GAL4-AD andcoexpressed...

Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

... Canyuk B, Focia PJ & Eakin AE (2001) The role foran invariant aspartic acid in hypoxanthine phospho-ribosyltransferases is examined using saturation muta-genesis, functional analysis, and ... (Grenoble,France) using a wavelength of 1.04 A ˚. The data were inte-grated using mosflm [29] and scaled using scala from the ccp4 software suit [30]. The structure was solved with the molecular replacement ... nucleotidebeing added to crystallization solutions. The ligandbound was interpreted as GMP because the N2 of the base makes a hydrogen bond to a main chain car-bonyl. Binding of a xanthine base from XMP...

Tài liệu Báo cáo khoa học: Structural and functional speciﬁcities of PDGF-C and PDGF-D, the novel members of the platelet-derived growth factors family docx

... protects the PDGFs against proteolyticdegradation, and may remove the PDGFs from circula-tion via a 2-macroglobulin receptors. There are no data currently available about interactions between the ... longervariant containing the CUB domain and the ﬁnal 30residues in the C-terminal end of the growth factordomain. These splice variants are also present inhuman thyroid papillary carcinomas (L. ... from their theo-retical sizes of 39 and 43 kDa based on their aminoacid sequences [8,12,29]. The divergence from the theoretical values indicates that PDGF-C and -D maybe post-translationally...

Báo cáo khoa học: Structural and functional aspects of unique type IV secretory components in the Helicobacter pylori cag-pathogenicity island potx

... cagC and cagf reached values analogous togenes important for bacterial survival and homeostasis,such as catalase, urease and NapA; by contrast, the transcript abundance of other cag genes appeared ... lymphoma [1–3]. CagA, a major anti-genic factor of the bacterium, is the main signature of the cagPAI-positive strains. Indeed, cagPAI confersH. pylori the capability to express and translocate the CagA ... protein rather than being a component of the T4SS apparatus. Finally, interaction studies indicatedthat CagI might interact with CagZ and CagG, andweak evidence of interaction with Cagb was alsoobserved...

Báo cáo khoa học: Relationship between functional activity and protein stability in the presence of all classes of stabilizing osmolytes ppt

... havetherefore measured the thermodynamic parameters of RNase -A in the presence of these amino acids andamino acid derivatives, and values of DGD°, measuredin triplicate, are given in Table ... Sigma. These and other chemicals, which were of analytical grade, were used without further puriﬁcation.Dialysis and the determination of the concentration of proteinAn RNase -A solution was dialyzed ... Dar TA, Haque I, Anjum F, Moosavi-Movahedi AA & Ahmad F (2007) Testing the paradigmthat the denaturing effect of urea on protein stability isoffset by methylamines at the physiological...

Báo cáo khoa học: Structural and functional roles for b-strand 7 in the a-crystallin domain of p26, a polydisperse small heat shock protein from Artemia franciscana pdf

... 5¢-CACGTACAAAGAGAACGTCGACGACG-3¢5¢-CGTCGTCGACGTTCTCTTTGTACGTG-3¢R11 4A 5¢-GAGAATTTCGAGCACGATACAGACTCCC-3¢5¢-GGGAGTCTGTATCGTGCTCGAAATTCTC-3¢Y116D 5¢-CGACGACGAGACAGACTCCCAGAACATGTC-3¢5¢-GACATGTTCTGGGAGTCTGTCTCGTCGTCG-3¢Y. Sun et al. ... assense and antisense, respectively, for each mutation.p26mutation PrimerR110G 5¢-GGACACGTACAAGGAGAATTTCGACGACG-3¢5¢-CGTCGTCGAAATTCTCCTTGTACGTGTCC-3¢F112R 5¢-CACGTACAAAGAGAACGTCGACGACG-3¢5¢-CGTCGTCGACGTTCTCTTTGTACGTG-3¢R11 4A ... Chaperones 8, 381–394.70 Rajaraman K, Raman B, Ramakrishna T & Rao CM(2001) Interaction of human recombinant aA- andaB-crystallins with early and late unfolding intermedi-ates of citrate...

Báo cáo khoa học: Molecular and functional characterization of novel CRFR1 isoforms from the skin pptx

... P763(5¢-TTCTCGAGACGCGTTATCGATAGAGAAATGTTCTGGC-3¢) and digested the PCR product with EcoRIand XhoI. The insert was synthesized with primers P764(5¢-AACTCGAGGCTAGTCTGCAGGAGCTCAAGCTTTCTAGAGAATTCA-3¢)andP765(5¢-TGAATTCTCTAGAAAGCTTGAGCTCCTGCAGACTAGCCTCGAGTT-3¢). ... pLuc. The minimal promoter containing TATA box wasampliﬁed from pcDNA6/V5-HisA vector (Invitrogen) byprimers P768 (5¢-AACTGCAGGAGCTCCCCATTGACGCAAATGGGCG-3¢), P769 (5¢-GGAAGCTTTTCGATAAGCCAGTAAGCAGTG-3¢), ... Cellsurface-anchored extracellular domain of the TSH Receptormodulates expression as well as basal and TSH-dependent acti-vation. Paper Presented at the Annual Meeting of the AmericanThyroid Association, November...

Xem thêm

Từ khóa: báo cáo khoa học mẫu báo cáo khoa học y học báo cáo khoa học sinh học báo cáo khoa học nông nghiệp báo cáo khoa học lâm nghiệp Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống chuyên đề điện xoay chiều theo dạng Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX Chuong 2 nhận dạng rui ro Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2 Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ