Báo cáo khóa học: A single mutation that causes phosphatidylglycerol deficiency impairs synthesis of photosystem II cores in Chlamydomonas reinhardtii pdf
Báo cáo khóa học: A single mutation that causes phosphatidylglycerol deficiency impairs synthesis of photosystem II cores in Chlamydomonas reinhardtii pdf
... single mutation that causes phosphatidylglycerol deficiency impairs synthesis of photosystem II cores in Chlamydomonas reinhardtii Bernard Pineau1, Jacqueline Girard-Bascou2, Stephan Eberhard2, ... the same segregation, as that observed for PSII activity and PG content.Translation initiation of thepsbAmRNA is not affected in themf2strainThe dramatic decrease in D1 synthesis in mf1 and ... detectable (Fig. 5A) , whereas synthe-sis of D2 and apoCP43 remained similar to those in the WTstrain. We noted that labelling of D1 and apoCP47 wereclearly detectable in 40 min pulses in mf1 and...
- 10
- 411
- 0
Báo cáo khoa học: A single mutation in Escherichia coli ribonuclease II inactivates the enzyme without affecting RNA binding pot
... knowledge of RNase II proteins. To date, thereare no structural or mutational data available from anyother proteins of the family. The SK4803 strain is par-ticularly interesting since the mutant ... (rnb296)encodes an inactive RNase II enzyme [25]. In thisreport we demonstrate that the single amino acid sub-stitution Asp209fiAsn in RNase II is able to cause thetotal inactivation of the enzyme ... His(6)-RNase IID209N(RNase IID209N) protein is indicated with an arrow. St, molecular mass maker.M. Amblar and C. M. Arraiano RNase II mutant with RNA binding but no activityFEBS Journal 272...
- 12
- 320
- 0
Tài liệu Báo cáo khoa học: A single amino acid substitution of Leu130Ile in snake DNases I contributes to the acquisition of thermal stability A clue to the molecular evolutionary mechanism from cold-blooded to warm-blooded vertebrates docx
... generating a thermally stable enzyme form from a thermally unstableone: frog, toad and newt DNases I all have a Ser205insertion in a domain that contains an essential Ca2+-binding site in ... the cDNAdata of E. quadrivirgata and A. blomhoffii, indicating that each putative upstream signal sequence containing the firstMet residue was 20 aa residues long. About 12% (33/283) of the aa residues ... climacophoraand A. blomhoffiiDNases ITotal RNA was isolated from each snake pancreas by theacid guanidinium thiocyanate/phenol/chloroform method[24] and any DNA contamination was removed by treat-ment...
- 8
- 500
- 0
Tài liệu Báo cáo khoa học: A point mutation in the ATP synthase of Rhodobacter capsulatus results in differential contributions of DpH and Du in driving the ATP synthesis reaction pptx
... A point mutation in the ATP synthase of Rhodobacter capsulatusresults in differential contributions of DpH and Du in drivingthe ATP synthesis reactionPaola Turina and B. Andrea MelandriDepartment ... 1.0 ATP/(F1F0Æs). These valuesare from a single preparation of chromatophores but arerepresentative of several preparations, obtained from strainscarrying mutated plasmids originating ... residue aGlu219, based on cross-linking data [11]. Several lines of evidence support a closespatial and functional interaction between aG lu219 andaHis245, including the f act that in the ATP...
- 9
- 580
- 0
Báo cáo khoa học: A single EF-hand isolated from STIM1 forms dimer in the absence and presence of Ca2+ ppt
... pore-form-ing subunit Orai1 [5]. STIM1 is a single transmem-brane-spanning protein with 685 amino acids whichcontains a canonical EF-hand motif and a sterile a- motif (SAM) domain in the ER ... synthesis or cleavage. Shaw et al. [9] firstreported that an isolated EF-hand III from skeletaltroponin C dimerizes in the presence of Ca2+. EF-hands from parvalbumin and calbindin D9K have ... host protein remainedunchanged. The impaired metal-binding ability causedby Asp to Ala mutations at positions 1 and 3 echoed a previous observation that these mutations in the intactSTIM1...
- 9
- 465
- 0
Báo cáo khoa học: A single mismatch in the DNA induces enhanced aggregation of MutS Hydrodynamic analyses of the protein-DNA complexes pot
... underline).Name Size (nt) SequenceCLL 121 5¢-TCACCATAGGCATCAAGGAATCGCGAATCCGCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCGATTTCGACACAATTTATCAGGCGAGCACCAGATTCAGCAATTAAGCTCTAAGCC- 3¢GTL 121 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGATCTGCTCCATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢GCL ... 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGATCTGCTCCATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢GCL 121 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGACCTGCTCCATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢CLE ... 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGACCTGCTCCATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢CLE 61 5¢-GCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCGGATTTCGACACAATTTATCAGGCGA-3¢GTE 61 5¢-TCGCCTGATAAATTGTGTCGAAATCCGCGATCTGCTCCATGTTACTTAGCCGGAACGAGGC-3¢GCE...
- 16
- 397
- 0
Báo cáo khoa học: "A Text Understander that Learns" doc
... we may annotate each assertional axiom of the form &apos ;a : C' and &apos ;a R b' by a corresponding hypothesis label h so that (a : C)h and (a R b)h are valid terminolog- ical ... terminological the- ory of a domain. Concepts are unary predicates, roles are binary predicates over a domain A, with individuals being the elements of A. We assume a common set-theoretical ... build on a given core ontology in the format of terminological assertions and, hence, make abundant use of terminological reasoning. The 'plain' text understanding mode can be consid-...
- 7
- 271
- 0
Báo cáo khoa học: A single intersubunit salt bridge affects oligomerization and catalytic activity in a bacterial quinone reductase pptx
... structures indicates that the side chain of K109plays a dual role by forming a salt bridge to D137, as well as stabilizing a glycine-rich loop in the vicinity of the FMN cofactor. In all protein vari-ants, ... D137L and K109D ⁄ D137K variants adopting a tetrameric assem-bly. Interestingly, all protein variants show a drastically reduced quinonereductase activity in steady-state kinetics. Detailed analysis ... mole-cular sieve chromatography. Each protein varianteluted as a single species; however, all protein variantsexhibited larger elution volumes indicating a lowerapparent mass (Table 2). These data...
- 12
- 407
- 0
Tài liệu Báo cáo khoa học: A DExD⁄ H box RNA helicase is important for K+ deprivation responses and tolerance in Arabidopsis thaliana docx
... andK+deprivation in plants remains to be elucidated.Besides, zeatin and cold treatments also increased theaccumulation of AtHELPS mRNA in seedlings(Fig. S1), suggesting that additional roles of AtHELPSmight ... impor-tant for cellular ion relationships in natural conditions.Increasing in ux, decreasing efflux or both can maxi-mize K+uptake to maintain K+homeostasis in plants[32,33]. Using the noninvasive ... critical for the bio-genesis of microRNAs and Arabidopsis development[24,25]. Arabidopsis TEBICHI, containing an N-termi-nal DELH box RNA helicase domain and a C-terminalDNA polymerase I domain,...
- 11
- 786
- 0
Báo cáo khoa học: "A GENERATIVE GRAMMAR APPROACH FOR THE MORPHOLOGIC AND MORPHOSYNTACTIC ANALYSIS OF ITALIAN" ppt
... dv2. andar© v.intran.simple I The other sets of data are contained in the Prolog workspace and are structured as tables of a relational data base. The set of the classes of endings is a table ... by Morreale, Campagnola and MugeUesi, as a research tool for teaching Italian morphology, with applications in automatic processin¢ of 32 natural language and knowledge representation 18]. ... lemma I stem ending dam synt=categ label matte matt da_bello adj.qualific. 1 mattino mattin dn_oggctto noun.common 3 di di prep.simple 2 andare vad dv 1 _andare v.intran.simple 1 andare and...
- 6
- 378
- 0
Từ khóa: chuyên đề điện xoay chiều theo dạngMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngThơ nôm tứ tuyệt trào phúng hồ xuân hươngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roTăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ