Báo cáo khoa học: C-terminal, endoplasmic reticulum-lumenal domain of prosurfactant protein C – structural features and membrane interactions ppt

... concen-tration. –1 2 –1 0 –8 –6 –4 –2 020<8A –1 0 –8 –6 –4 –2 0210 220 230 240 250 260λ λ (nm)80<Bθθ –1 0 –8 –6 –4 –2 00246810Urea (M) C Fig. 4. Effects of urea on CTC secondary structure. CD spectra of CTC in 0–8 M urea ... human CTC and the effects of CTC membrane interaction on protein structure. CTC forms noncovalent trimers and supratrimeric oligo-mers. It contains two intrachain disulﬁde bridges, and its secondary ... unfoldingCD spectra of nonreduced and reduced CTC in thepresence of increasing amounts of urea are shown inFig. 4A,B. Nonreduced CTC showed small and continuous changes in the spectra between 0 and...

Báo cáo khoa học: A novel transmembrane topology of presenilin based on reconciling experimental and computational evidence pptx

... involved in c- secretasecomplex assembly and activity [1 1–1 6] and is requiredfor endoplasmic reticulum (ER) retention [13]. It is theconserved ‘PAL’ sequence in the C- terminal part of the protein ... molecularspecies of PS coexisting in the cell differing in the loca-tion of the C- terminus. This would implicate that the C- terminal region could interact with factors in boththe cytosol and ... of endopro-teolytic cleavage in PS1 is between T291 and M292 [5],which is located in HRVII. The ﬁrst evidence that theNTF–CTF heterodimers are the biologically activeform of PS and part of...

Tài liệu Báo cáo khoa học: Mapping the functional domain of the prion protein docx

... OligonucleotidePrP2 3–1 12GCATGTGGCAGGGCTCGAGGCAGCTGGGGCPrP2 3–1 71 GCAACCAGCTCGAGTTCGTGCACGPrP4 5–2 31 GGGAAGCCATATGGGCAACCGPrP9 0–2 31 GCCCCATGGCGGTGGATGGCATATGGGAGGGGGTACCCPrP10 5–2 31 GGAACAAGCCCAGCCATATGAAAACCAACCTCAAGCPrP11 3–2 31 CCAACCTCAAGCATATGGCAGGGPrPD3 5–4 5 ... CCAACCTCAAGCATATGGCAGGGPrPD3 5–4 5 GGGTGGAACACCGGTGGCAACCGTTACCCPrP11 2–1 19 CCTCAAGCATGTGGTAGTGGGGGGCCPrPD11 2–1 36 CCAACCTCAAGCATGTGATGATCCATTTTGGCPrPD13 5–1 50 GCGCCGTGAGCGAAAACATGTACCGCÓ FEBS 2003 PrP functional domains ... Binding of Cu to the protein inﬂuences its abilityto interact with other proteins such as plasminogen [24] and glycosaminoglycans [25].Knockout of PrP c causes a decrease in cellular resistanceof...

Báo cáo khoa học: Correlation between conformational stability of the ternary enzyme–substrate complex and domain closure of 3-phosphoglycerate kinase potx

... 59.2 59.8 127 49.4 51.3 60 56.0 55.7 12655.6a – – – – – – – MgADP 56.9 57.0 139 48.7 98 60.7 61.4 140 51.5 52.3 73 57.0 57.5 13057.6a – – – – – – – 3-PG 58.2 57.5 147 52.4 110 60.1 60.0 150 51.4 ... 15059.8b – – – – – – – aPublished values, taking into account the decreasing effect of Mg2+on PGK stability [83].bExtrapolated to zero concentration of freeMg2+using the method described ... molecularcontacts were collected and visually investigated: (a)backbone peptide H bonds; (b) electrostatic and H-bonding contacts; (c) hydrophobic interactions between side chains of the conserved...

Báo cáo khoa học: The calcium-binding domain of the stress protein SEP53 is required for survival in response to deoxycholic acid-mediated injury pdf

... 5¢)3¢ CAGTCAAGCTTATGCCTCAGTTACTGCAAAAC and reverse5¢)3¢ CATAGCTCGAGTCATGGCTTGGTGCTTCTC;(b) DCa–SEP53, forward 5¢)3¢ TGCTAGAATTCAGATCTATGAGCGAGAGTGCTGAGGGA and reverse 5¢)3¢TGCTATCTAGATCATGGCTTGGTGCTTCT. ... sequences of the oligonucleotides usedin the ampliﬁcation of SEP53 are: forward 5¢-CATAGCTCGAGCTATGCCTCAGTTACTGCAAAACATT-3¢;reverse 5¢-CAGTCAAGCTTCATGGCTTGGTGCTTCTCAAGT-3¢. Oligonucleotides ... acid (CDCA),ursodeoxycholic acid (UDCA), lithocholic acid (LCA) and cholic acid (CA), with both conjugated and unconjugated (Fig. 2B,E) forms being identiﬁed. Theprimary bile acids, CA and CDCA,...

Tài liệu Báo cáo khoa học: A novel splice variant of occludin deleted in exon 9 and its role in cell apoptosis and invasion docx

... Fig. 8A, OccWT-transfected cells showed increased cytoplasmic calciumconcentrations, whereas OccDE9-transfected and con-trol-transfected cell did not show any changes incalcium concentration ... to cell apoptosis and invasion [21,22].ABFig. 3. Localization of OccWT and OccDE9. (A) OccWT and OccDE9were cloned into pCMV ⁄ HA, a mammalian overexpression vector(pCMV ⁄ HA-OccWT and ... the occludin variant waslocalized in the membrane, we cloned the OccWT and OccDE9genes into pCMV ⁄ HA and performed immuno-cytochemistry. The expression of each construct inChang, Hep3B and...

Tài liệu Báo cáo khoa học: Insights into the interaction of human arginase II with substrate and manganese ions by site-directed mutagenesis and kinetic studies Alteration of substrate speciﬁcity by replacement of Asn149 with Asp docx

... 5¢-CTGGGAGGAGACAACAGCCTGGCAATC-3¢ for His120Asn, 5¢-TGGGTTGATGCCAATGCTGACATCAAC-3¢ for His145Asn and 5¢-TGACATCGACACACCCC-3¢ for Asn149Asp.Fluorescence spectra and thermal inactivationstudiesFluorescence ... 5¢-gattgccaggctgttgtctcctcccag-3¢,5¢-GTTGATGTCAGCATTGGCATCAACCCA-3¢ and 5¢-GGGGTGTGTCGATGTCA-3¢ for His120Asn, His145Asn and Asn149Asp, respectively. The corresponding sense muta-genic oligonucleotide primers were 5¢-CTGGGAGGAGACAACAGCCTGGCAATC-3¢ ... detected bythe chromatographic procedures used for their puriﬁ-cation. In view of these results, at least gross structural changes can be discarded as a consequence of themutagenic replacements.Effects...

Tài liệu Báo cáo khoa học: "Toward finer-grained sentiment identification in product reviews through linguistic and ontological analyses" ppt

... syntactic clues into 4 groups of likeness (L), contrary (C) , cause-effect (CE), and contrary with contrastive markers (CC). Wilson and colleagues (2006) selected some syntactic clues as features ... Syntactic and Lexical Clues: Descriptions of each attribute in the reviews are often expressed 170in a phrase or clause, so that conjunctions, or endings of a word with a conjunctive marker ... concepts, we constructed a domain specific semi-hierarchical network for clothes of the Clothing-Type structure, in addition to the Review struc-ture, by utilizing hierarchical category informa-tion...

Báo cáo khoa học: Amyloid oligomers: spectroscopic characterization of amyloidogenic protein states docx

... suchas in the case of chaperone action. Restricting us toamyoidic structures, techniques such as NMR [21],EPR [22], electron microscopy and atomic forcemicroscopy [23] and X-ray diffraction [24], ... monitoring of ﬁbril growth is essential, but is also very technicallydemanding. This article reviews a selection of spectro-scopic techniques, predominantly ﬂuorescence tech-niques, recently used and ... oligomers: spectroscopic characterization of amyloidogenic protein statesMikael Lindgren1 and Per Hammarstro¨m21 Department of Physics, Norwegian University of Science and Technology, Trondheim,...

Báo cáo khoa học: "A Cost Sensitive Part-of-Speech Tagging: Differentiating Serious Errors from Minor Errors" pptx

... performance. They achieve an ac-curacy of 96.08% and around 93.9 F1-score. On theother hand, CL-MSVM achieves 96.13% accuracy and 94.00 F1-score. The accuracy and F1-score of TL-MSVM are 96.12% and ... Proceedings of the Human Language Technology and North American Chapter of the Association forComputational Linguistics. pp. 25 2–2 59.Kristina Toutanova and Christopher D. Manning. 2000.Enriching ... 56 7–5 72.1034Proceedings of the 50th Annual Meeting of the Association for Computational Linguistics, pages 102 5–1 034,Jeju, Republic of Korea, 8-14 July 2012. c 2012 Association for Computational LinguisticsA Cost...

Xem thêm

Từ khóa: báo cáo khoa học mẫu báo cáo khoa học y học báo cáo khoa học sinh học báo cáo khoa học nông nghiệp báo cáo khoa học lâm nghiệp báo cáo khoa học thủy sản Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế Thơ nôm tứ tuyệt trào phúng hồ xuân hương Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX Chuong 2 nhận dạng rui ro Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ