... samples to 95 °C on a thermal heating block and cooling to 4 °C at a rate of 2 °CÆmin–1.Name SequencessDNAS d(CATTCCCACCGGGACCACCAC)ssDNA L d(CATTCCCACCGGGACCACCACCATTCCCACCGGGACCACCAC)ETS-1 ... The Ewing’ssarcoma gene product functions as a transcriptionalactivator. Cancer Res 61, 2 690 –2 695 .51 Ishii S, Imamoto F, Yamanashi Y, Toyoshima K &Yamamoto T ( 198 7) Characterization of the ... methyltransferase 1 and 3 towardthe Ewing sarcoma protein and a peptide. Proteins 61,164–175.48 Raman B, Guarnaccia C, Nadassy K, Zakhariev S,Pintar A, Zanuttin F, Frigyes D, Acatrinei C, Vindigni A, ...