Báo cáo khoa học: Heterologous synthesis of cytochrome c¢ by Escherichia coli is not dependent on the System I cytochrome c biogenesis machinery ppt

... Heterologous synthesis of cytochrome c by Escherichia coli is not dependent on the System I cytochrome c biogenesis machinery Hiroki Inoue1, Satoshi Wakai1, Hirofumi Nishihara2and ... cytochromes c , including the latter. Heterologous synthesis of PHCP by E. coli The E. coli System I cytochrome c biogenesis machin-ery, consisting of the Dsb and Ccm proteins, is respon-sible ... System I machinery. Unlike Ambler’s class I general cytochromes c, the synthesis of PHCP is not dependent on the System I machinery and exhibits similarity to that of E. coli periplasmiccytochrome...

Báo cáo khoa học: Catalytic activation of human glucokinase by substrate binding – residue contacts involved in the binding of D-glucose to the super-open form and conformational transitions ppt

... fluorescence response, [S] is the ligand concentra-tion and Kd is the equilibrium dissociation constant definedas the ligand concentration of half maximal increase influorescence intensity.Temperature-induced ... noticeably upon Glcbinding (Fig. 8B ,C) . The changes in the interhelicalinteractions point to a major contribution in the dynamic communication between the L- andS-domains and thus in the transition ... in helix 5 (H5), CR II andhelix 6 (H6) illustrating the large changes in main-chain torsion angleswhich occur at CR II (residues 191–203) upon binding of Glc. The position of the Glc contact...

Báo cáo khoa học: Heterologous expression of a serine carboxypeptidase-like acyltransferase and characterization of the kinetic mechanism potx

... cultivation conditions or gene dosage, and toupscale biomass production by fermenter cultivationfor S. cerevisiae.Optimization of AtSMT expression inS. cerevisiaeSequence optimizationEfﬁcient ... Ternary complex dissociation constants weredetermined by calculating the reciprocal intersections of the reciprocal apparent maximal catalytic activity (Vmaxapp)1)versus reciprocal substrate concentration ... expressSMT in yeast.Fig. S3. Indication of high gene dosage of leu2-d by increased plasmid copy number.Fig. S4. Estimation of the dissociation constants.Fig. S5. Estimation of the ternary complex dissociationconstants.Table...

Tài liệu Báo cáo khoa học: Evolutionary divergence of valosin-containing protein ⁄cell division cycle protein 48 binding interactions among endoplasmic reticulum-associated degradation proteins ppt

... degeneration protein(WldS), this time into discrete intranuclear foci [8].Although this is not the normal distribution of VCP,these foci do provide a site for speci c colocalizationstudies, ... N-terminal, VBM-containing 16 amino acids of Ube4b blocks binding of the otherwise intact protein[8], this indicates similarities between the VCP-bindingsites of intact ERAD proteins and those indicated ... and on the VCP–Cdc48p side.We then investigated whether the binding of each of these VBM-containing proteins to the N-domain of VCP is disrupted in disease. Several mutations within the N-domain...

Tài liệu Báo cáo khoa học: Metabolic control of mitochondrial properties by adenine nucleotide translocator determines palmitoyl-CoA effects Implications for a mechanism linking obesity and type 2 diabetes pdf

... intermediate concentration(for concentration control coefficients) in response to 1%inhibition of the reaction rate of that enzyme. The elasticity coefficient is defined as the fractionalchange in rate ... consumption of excess fat. However, the combination of persistent ANT inhibition by LCACs with constantactivation of AMPK may have some adverse effects,because stimulation of b-oxidation in ... affect cellular function by directeffects on a variety of enzymes and induction of apoptosis [4].Tight regulation of intracellular concentrations of free LCACs by acyl-CoA-binding protein can...

Tài liệu Báo cáo khoa học: "Unsupervised Segmentation of Chinese Text by Use of Branching Entropy" pdf

... Proceedings of the COLING/ACL 2006 Main Conference Poster Sessions, pages 428–435,Sydney, July 2006. c 2006 Association for Computational Linguistics428 0.5 1 1.5 2 ... 2 3 4 5 6 7 8entropyoffset429430431432 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1 0.55 0.6 0.65 0.7 0.75 0.8 0.85 0.9 0.95 1recallprecisionBincreaseBordinaryBmax433 0 0.1 ... 1recallprecisionBincreaseBordinaryBmax433 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1 10 100 1000 10000 100000 1e+06size(KB)recallprecision434...

Báo cáo khoa học: Crystal structure of salt-tolerant glutaminase from Micrococcus luteus K-3 in the presence and absence of its product L-glutamate and its activator Tris pdf

... (F)consists of the conserved N-terminal domain that con-tains active-site residues and part of the C- terminaldomain. The structure of the N-terminal domain is conserved among species (E. coli, ... which is distinct from the corresponding structures in the N, T and G forms, inwhich Tris is not identiﬁed.In contrast to l-glutamate, Tris binding induces alesser degree of structural changes, ... Tris, and Tris analogues, such as Bistris ortricine, induce no such effect. Similar speci c activa-tions have also been observed in other proteins [24–30]. As shown in Fig. 8, Tris is identiﬁed...

Báo cáo khoa học: Identiﬁcation of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt

... cells.DiscussionA major problem in the clinical chemotherapeutictreatment of cancer is intrinsic or acquired resistanceto current chemotherapeutic agents [11], particularly the acquisition of MDR. This ... AGCTGGTGCAGGAGGAAGTA TCTCACTGGCCCTAAACTGG 92AL707095 CCGAGAACCGAACTTACCAA CTGATAGGGGTTGGGTGATG 128AK095731 AGGAAGCACCCAGCAATACCA GCATTTCCATTTCCCTAAGCAC 109DKK1 CACCTTGGATGGGTATTCCA CAACACAATCCTGAGGCACA ... underlines the criticalimportance of exploring the molecular mechanismsinvolved in the drug resistance of cancer cells forimproving current treatments in the clinic.PYM is widely used in the...

Báo cáo khoa học: Dual modulation of prothrombin activation by the cyclopentapeptide plactin pptx

... Xa. Thismechanism may participate in the enhancement of ﬁbrinolytic activity in the U937 cell system, in whichplactin enhances prothrombin activation and the for-mation of inactive tcu-PA ... prothrombin activa-tion (thrombin formation) was involved in the mecha-nism of plactin action and that plactin affected thisreaction. Indeed, plactin D increased prothrombinactivation in the U937 ... coagulation reaction proceeds viamembrane-associated processes. Plactin inhibits pro-thrombin activation catalyzed by membrane-associatedXa. This is consistent with the observation that plactininhibits...

Báo cáo khoa học: Biochemical characterization of USP7 reveals post-translational modiﬁcation sites and structural requirements for substrate processing and subcellular localization pptx

... to achieve nuclear localization in USP7, an obser-vation which is in line with previous studies [17]. Sincebioinformatics tools did not anticipate any functionalnuclear localization signal ... con-formational changes triggered by the interaction withubiquitin. A similar mechanism was described the same year for the activation of the structural homo-logue calpain by calcium ions [26]. Interestingly,here ... evidence accumulates in favor of its potential astherapeutic target in cancer indications. The molecularinsight provided by the crystal structure of its catalyticdomain in complex with ubiquitin...

Xem thêm

Từ khóa: báo cáo khoa học mẫu báo cáo khoa học y học báo cáo khoa học sinh học báo cáo khoa học nông nghiệp báo cáo khoa học lâm nghiệp báo cáo khoa học thủy sản Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại Một số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTP Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh Phối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọ Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin Thơ nôm tứ tuyệt trào phúng hồ xuân hương Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX Chuong 2 nhận dạng rui ro Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015 Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam