0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Tài liệu Báo cáo khoa học: Purification and characterization of a sialic acid specific lectin from the hemolymph of the freshwater crab Paratelphusa jacquemontii pdf

Tài liệu Báo cáo khoa học: Purification and characterization of glutamate N-acetyltransferase involved in citrulline accumulation in wild watermelon doc

Tài liệu Báo cáo khoa học: Purification and characterization of glutamate N-acetyltransferase involved in citrulline accumulation in wild watermelon doc

... number AI563351) was used to design fourGAT -specific primers; CLGAT 5a (5¢-GGCATCAACAT-CACAAGCAACAAGTGCAAG-3¢), CLGAT5b (5¢-TCCT-CCATCAATCTGCTTCCATGGACCATC-3¢), CLGAT 3a (5¢-GCTGTGGCTACGAATGAGGCCGCC-3) ... FEBS Purification and characterization of glutamateN-acetyltransferase involved in citrulline accumulationin wild watermelonKentaro Takahara, Kinya Akashi and Akiho YokotaGraduate School of ... NotI-d(T)18bifunctional primer (5¢-TAA-CTGGAAGAATTCGCGGCCGCAGGAAT(18)-3¢). The single-stranded cDNA was used for PCR w ith the primers Not1(5¢-AACTGGAAGAATTCGCGGCCGC-3¢) and CLGAT 3a. An aliquot from t...
  • 12
  • 649
  • 0
Tài liệu Báo cáo khoa học: Purification and characterization of a sialic acid specific lectin from the hemolymph of the freshwater crab Paratelphusa jacquemontii pdf

Tài liệu Báo cáo khoa học: Purification and characterization of a sialic acid specific lectin from the hemolymph of the freshwater crab Paratelphusa jacquemontii pdf

... Purification and characterization of a sialic acid specific lectin from the hemolymph of the freshwater crab Paratelphusa jacquemontii Maghil Denis, P. D. Mercy Palatty, N. Renuka Bai and S. ... increase in specific activity. Analysis of the lectin on SDS/PAGE gave a singleband at apparent molecular mass of 34 kDa. The binding affinity of the lectin in the hemolymph of the freshwater crab, ... sialidasetypeX,proteaseenzymes and molecular mass standards were purchased from Sigma.Preparation of crab sera Freshwater field crabs, Paratelphusa jacquemontii werecollected from the local...
  • 8
  • 616
  • 0
Tài liệu Báo cáo khoa học: Purification and characterization of a membrane-bound enzyme complex from the sulfate-reducing archaeon Archaeoglobus fulgidus related to heterodisulfide reductase from methanogenic archaea pdf

Tài liệu Báo cáo khoa học: Purification and characterization of a membrane-bound enzyme complex from the sulfate-reducing archaeon Archaeoglobus fulgidus related to heterodisulfide reductase from methanogenic archaea pdf

... with anapparent molecular mass of 53 kDa appears as a double band inunboiled samples (lanes A1 and B1).Table 1. N-Terminal sequences of the polypeptides of the purified enzyme. N-Terminal sequen ... with g values at 2.031,1.994, and 1.951. The resonance started to develop atpotentials ‡ 0 mV and was stable at potentials up to+350 mV. The loss and formation of the resonance wasassociated ... related to the catalyticsubunit of Hdr from methanogenic archaea have beendeposited in the databases. None of these putative pro teinshas b een c haracterized and no f unction has been assigned...
  • 10
  • 564
  • 0
Tài liệu Báo cáo khoa học: Purification and structural characterization of a D-amino acid-containing conopeptide, conomarphin, from Conus marmoreus docx

Tài liệu Báo cáo khoa học: Purification and structural characterization of a D-amino acid-containing conopeptide, conomarphin, from Conus marmoreus docx

... M, Teramoto T, Kumagaye KY, Nakajima K,Watanabe T, Kawai T, Kawakami Y, Niidome T,Sawada K, Nishizawa Y et al. (1994) Omega-agatoxin-TK containing D-serine at position 46, but not syn-thetic ... China Sea. Sephadex G-25 was purchased from Amersham Biosciences (Uppsala, Sweden), a ZORBAX300SB-C18 semipreparative column was from Agilent Tech-nologies (Santa Clara, CA, USA), and trifluoroacetic ... Inoue A, Kawakami Y, Nishizawa Y, Katayama K & KuwadaM (1995) Isolation and characterization of a peptideisomerase from funnel web spider venom. J Biol Chem270, 16719–16723.34 Torres AM,...
  • 12
  • 616
  • 0
Tài liệu Báo cáo khoa học: Purification and cDNA cloning of a cellulase from abalone Haliotis discus hannai ppt

Tài liệu Báo cáo khoa học: Purification and cDNA cloning of a cellulase from abalone Haliotis discus hannai ppt

... CTGATCTAGAGGTACCGGATCC5RACF ATCCTCACGAACAAGCAG5RACR GATCGCGATGCAGGCCTTFLF1 GGACGACTACAGCGTCTTCAGTAGAFLR1 TCCAAACAGTCAGTTTCTTAACCGTTable 1. Purification of cellulase from abalone Haliotis discus hannai. ... of the cDNA library and cloning of cellulasecDNA was achieved as follows: Total RNA was extracted from 1 g of abalone hepatopancreas by the ganidiniumthiocyanate-phenol method [30] and mRNA ... Tokyo, Japan) and used as an abalone cDNAlibrary. cDNAs encoding abalone cellulase were amplifiedby PCR from the cDNA library with degenerated primerssynthesized on the basis of partial amino-acid...
  • 8
  • 511
  • 0
Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx

Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx

... 3¢-RACEZf3¢stat6-F2 CGGTAGTCAGGAAATCAATGCC 3¢-RACEZf5¢stat6-R1 CCATGTCTGCAGATGGTCGAGG 5¢-RACEZf5¢stat6-R2 GGACTGACATTGCTCCAGAGC 5¢-RACEZf3¢stat6-F3 GCTTCAGTGACTCAGAAATTGG 3¢-RACEZf3¢stat6-F4 GTCCAGAATATTCAGCCTTTCACC ... CTGGATTGAAGCGCCCTCGGTTAATC 3¢-RACEZf5¢tbet-R1 GCTGCCTTTGTTATTTGTAAGCTTCAG 5¢-RACEZf5¢tbet-R2 GGAAACTTCCTGTCTCATCCAGTG 5¢-RACEZffoxp3-F1 GGAACACACAGAGGGGATGATA Initial PCRZffoxp3-R1 CTTCAACACGCACAAAGCAC Initial ... GTCCAGAATATTCAGCCTTTCACC 3¢-RACEZftbet-F1 CTCCCTCAAACAAACCAGAGTC Initial PCRZftbet-R1 CACTGGATGAGACAGGAAGTT Initial PCRZf3¢tbet-F1 CTTCTCCAGGACAGTCCAAAGAGTC 3¢-RACEZf3¢tbet-F2 CTGGATTGAAGCGCCCTCGGTTAATC...
  • 20
  • 689
  • 0
Tài liệu Báo cáo khoa học: Identification and characterization of an R-Smad ortholog (SmSmad1B) from Schistosoma mansoni pdf

Tài liệu Báo cáo khoa học: Identification and characterization of an R-Smad ortholog (SmSmad1B) from Schistosoma mansoni pdf

... P(2000) The transcriptional co-activator P ⁄ CAF potenti-ates TGF-beta ⁄ Smad signaling. Nucleic Acids Res 28,4291–4298.39 Kahata K, Hayashi M, Asaka M, Hellman U,Kitagawa H, Yanagisawa J, Kato ... DeMarco R, Martins EA,Guimaraes PE, Ojopi EP, Paquola AC, Piazza JP,Nishiyama MY Jr, Kitajima JP, Adamson RE et al.(2003) Transcriptome analysis of the acoelomate humanparasite Schistosoma ... R-Smads, such as a nuclear localizationsignal and a DNA-binding domain in the MH1 domain and the L3 loop, and the C-terminal, receptor phos-phorylation motif in the MH2 domain (Fig. 1A) . The amino...
  • 19
  • 653
  • 0
Tài liệu Báo cáo khoa học: Identi®cation and properties of type I-signal peptidases of Bacillus amyloliquefaciens doc

Tài liệu Báo cáo khoa học: Identi®cation and properties of type I-signal peptidases of Bacillus amyloliquefaciens doc

... GAGAATTCAAAAGAAAGCGGGGAAGAA Construction of pOpacWhW12 CGAGATCTTGTGGACATGGTCCCGTTTC Construction of pOpacWhS1 CGGAATTCGCTAATGGGAGGAAATCAC Construction of pOpacShS2 TACAGATCTTTTCGTCTTGCGAATTTC ... of sipWW7 TTGTGTAAAAGTGATGACATCGCC Cloning of sipWW8 GTGATCCCGATTATTCTGTGTGTT Cloning of sipWW9 GGCGATGTCATCACTTTTACACAA Cloning of sipWW10 AACACACAGAATAATCGGGATCAC Cloning of sipWW11 GAGAATTCAAAAGAAAGCGGGGAAGAA ... of sipVV4 GCCAAAACAACGATAAGCACGCC Cloning of sipVV5 GGATTCATGCTGATTCCTTCGAC Cloning of sipVV6 ACTTGGCACTACACCGCACCTCATGCG Cloning of sipVV7 ATTTCGTGATTGGCGACAACCGC Cloning of sipVV8 GAGAATTCCGGAGGGGGACAGGAATCTTG...
  • 12
  • 595
  • 0
Tài liệu Báo cáo khoa học: Molecular cloning and characterization of soybean protein disulfide isomerase family proteins with nonclassic active center motifs pdf

Tài liệu Báo cáo khoa học: Molecular cloning and characterization of soybean protein disulfide isomerase family proteins with nonclassic active center motifs pdf

... with a Thermal Cycler Dice RealTime System (TaKaRa Bio Inc.). Forward primers 5¢-CGTTTGAAGGGTGAGGAGGAAAA[FAM]G-3¢ and 5¢-CACAAGAGAGTTCTGCGATAACCTTG[FAM]G-3¢ (Invi-trogen Corporation) and reverse ... reverse primers 5¢-AAGTAGGCAACAAAACAACG-3¢ and 5¢-GTTTTCCCGACAATAA-CATGG-3¢ were used for detecting GmPDIL- 3a and GmPDIL-3b, respectively. Primers for quantification of actin mRNA were as described ... redox-active CGHC motifs with methionine or isoleucine and asparagine in GmPDIL- 3a and GmPDIL-3b maybe the cause of the lack of such enzymatic activities.Alternatively, the lack of other amino acids,...
  • 12
  • 622
  • 0
Tài liệu Báo cáo khoa học: Endogenous expression and protein kinase A-dependent phosphorylation of the guanine nucleotide exchange factor Ras-GRF1 in human embryonic kidney 293 cells pptx

Tài liệu Báo cáo khoa học: Endogenous expression and protein kinase A-dependent phosphorylation of the guanine nucleotide exchange factor Ras-GRF1 in human embryonic kidney 293 cells pptx

... ON357, 5¢-TGAAACATCACCAACTAAATCTCCAA-3¢; ON358, 5¢-GACGACTCCATTGTTATAGGAAAAGAGT-3¢; ON359, 5 ¢-GCCGCTGGAGAAACAGCAT-3¢; ON360, 5¢-GCCACCCATTCGTCACAATC-3¢; and ON361, 5¢-ATGCAGAAGGGGATCCGG-3¢.Direct ... overexpression of Epac and mimicked by a cAMPanalogue stimulating both PKA and Epac, but not byan Epac -specific cAMP analogue [25]. The differences inH89 sensitivity and possible signalling pathwaysinvolved ... in the supernatants were quanti-fied by the BC assay quantification kit (Uptima) using BSAas the standard. Equal amounts of protein were preparedfor separation by SDS ⁄ PAGE.ImmunoprecipitationHEK293...
  • 13
  • 730
  • 0

Xem thêm

Từ khóa: tài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdftài liệu báo cáo nghiên cứu khoa họctài liệu về báo cáo khoa họcbáo cáo khoa học công nghệ phục vụ nông nghiệp và phát triển nông thôn các tỉnh phía bắc 2006 2007 tài liệu phục vụ hội nghịbáo cáo khoa học tài chính côngbáo cáo khoa học số loài quý hiếm tại vườn quốc gia ba bểtai lieu bao cao thuc tap khoa co khitai lieu bao cao thuc tap tai khoa duoc benh vientai lieu bao cao thuc tap y si da khoabáo cáo khoa học ảnh hưởng của tuổi thu hoạch đến năng suất và chất lượng thức ăn của cỏ voi pennisetum purpureum cỏ ghi nê panicum maximum trồng tại đan phượng hà tây pptxtai lieu bao cao thuc tap tim hieu nhan cach mot hoc sinhbáo cáo khoa học về nghệ thuật trong lieu trai chi ditai lieu bao cao thuc tap tai khoa duoc benh vien hop lucđề tài báo cáo khoa họcđề tài báo cáo khoa học sinh họcNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDENghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ