Tài liệu Báo cáo khoa học: Puriﬁcation and characterization of glutamate N-acetyltransferase involved in citrulline accumulation in wild watermelon doc

... massive accumulation of citrul-line in wild watermelon. As a first step to understand the mechanism of citrul-line and arginine accumulation in wild watermelon, wefocused on the fifth step of citrulline ... cit-rulline and arginine.ResultsThe enzyme involved in catalysis of the fifth step of citrulline biosynthesis in wild watermelon leavesDuring citrulline biosynthesis, N-acetylornithine is con-verted ... glutamate N-acetyltransferase involved in citrulline accumulation in wild watermelon Kentaro Takahara, Kinya Akashi and Akiho YokotaGraduate School of Biological Sciences, Nara Institute of Science and...

Tài liệu Báo cáo khoa học: Puriﬁcation and characterization of a sialic acid speciﬁc lectin from the hemolymph of the freshwater crab Paratelphusa jacquemontii pdf

... CNBr-activated Sepharose 4B, bovine submaxillarymucin, porcine stomach mucin, bovine and porcine thyro-globulin, fetuin, transferrin, N-acetyl mannosamine, gluco-samine and galactosamine, lactose, glucose-6-phosphate,sucrose, ... lectin was sialic acid on the surface of erythrocytes.The binding speciﬁcity of crab lectinInhibition studies with various sugars was helpful in deducing the binding speciﬁcity of the lectin. ... bufferscontained the calcium required for binding of lectin toBSM–agarose. Lectin was eluted with EB containing 10 mMEDTA, and 1 mL fractions collected on ice in polypropy-lene tubes containing 100...

Tài liệu Báo cáo khoa học: Puriﬁcation and characterization of a membrane-bound enzyme complex from the sulfate-reducing archaeon Archaeoglobus fulgidus related to heterodisulﬁde reductase from methanogenic archaea pdf

... vulgaris, and HybA, DmsB, and N rfC f rom E. coli. Some members, including AF499,have an N-terminal Ôtwin-arginineÕ signal sequence that ischaracteristic of cofactor-containing proteins translocatedinto ... contains an FAD-binding motif and four binding motifs for [4Fe-4S] clusters. HdrCcontains two additional binding motifs for [4Fe-4S]clusters [2].Hdr in t he two closely relate d Methanosarcina ... AF502, DsrK, and HmcFclearly identiﬁed the t wo typical CXXCXXCXXXCPbinding motifs for [4Fe-4S] clusters in the N-terminal part of these proteins. AF502, DsrK, and HmcF also containone of the two...

Tài liệu Báo cáo khoa học: Identiﬁcation and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebraﬁsh, Danio rerio docx

... seen in the putative T-boxDNA-binding domain of t-bet, the STAT protein inter-action domain, STAT protein all-alpha domain, STATprotein DNA-binding domain and SH2 domain of stat6, and the zinc-ﬁnger ... FOX proteins, a leucine zipper domain and a C2H2 zinc ﬁnger domain, both of which arethought to help mediate DNA binding and may be involved in the induction of dimerization [43]. Each of these ... expression of T-bet has beenseen within a wide variety of tissues and cells in theGinbuna crucian carp [27] and, in mammals, in thelung tissue of mouse and spleen and thymus of human and mouse...

Tài liệu Báo cáo khoa học: Identiﬁcation and characterization of an R-Smad ortholog (SmSmad1B) from Schistosoma mansoni pdf

... representing the 5¢- and 3¢-UTRs areshown in white in the genomic gene and the cDNA. Intron size in bp, domain size in bp and domain size in amino acids are indicated at thebottom of each schematic ... address these interactions in in vitro and in vivo surrogate systems. In this study, protein interaction experiments havedemonstrated that SmSmad1B and SmSmad1 sharesimilar binding properties. ... protein and bound to amylose resin. SmTbRI or SmTbRI-QDrecombinant pCITE-4a vectors were in vitro translated in the presence of [35S]methionine, and 5 lL of the labeled reac-tions were incubated...

Tài liệu Báo cáo khoa học: Puriﬁcation and structural characterization of a D-amino acid-containing conopeptide, conomarphin, from Conus marmoreus docx

... superimposedstructures of conomarphin (red) and L-Phe13-conomarphin (gray). The side chain of L-Phe13 might cause spatial hindrance tothe side chain of Lys9 and Hyp10 in formingthe tight loop as in conomarphin. ... sidechain of Lys9, Hyp10 and D-Phe13 of cono-marphin is shown in stick mode, and theside chain of L-Phe13 in L-Phe13-conomar-phin is shown as a gray stick.Y. Han et al. AD-amino acid-containing ... Academy of Sciences, China3 Department of Chemistry, Renmin University of China, Beijing, China4 Research Institute of Pharmaceutical Chemistry, Beijing, ChinaConus snails are a group of predatory...

Tài liệu Báo cáo khoa học: Puriﬁcation and cDNA cloning of a cellulase from abalone Haliotis discus hannai ppt

... theGHF9-cellulase possessing a family II CBM in the N-ter-minal region. By genomic PCR using speciﬁc primers to the3¢-terminal coding sequences of HdEG66-cDNA, a DNA of 2186 bp including three introns was ... three cysteines are however presentat residues 33, 58, and 90. In addition, a putative linkerregion rich in threonine and glycine residues locates in the position connecting the N-terminal extended ... indicated by a dotted underline. The amino-acid sequences determined with intact HdEG66 (N-terminus) and peptidesLP1–LP9 are indicated by lines under the amino-acid sequence. The positions of...

Tài liệu Báo cáo khoa học: Identi®cation and properties of type I-signal peptidases of Bacillus amyloliquefaciens doc

... PstIandEcoRI in case of sipV or EcoRI-SacIincaseofsipW and ligated into corresponding sites of pUC18 DNA. The ligation mixes were used for PCR with oligo nucleotides Uni1 or Uni2 and pairs of ... TCNGCNGCNGCRTTRTTRTCNCCYTTNGT Cloning of sipWW7 TTGTGTAAAAGTGATGACATCGCC Cloning of sipWW8 GTGATCCCGATTATTCTGTGTGTT Cloning of sipWW9 GGCGATGTCATCACTTTTACACAA Cloning of sipWW10 AACACACAGAATAATCGGGATCAC Cloning of sipWW11 ... Cloning of sipVV3 TCNGCRTCNSWNATNACNCCNACNAT Cloning of sipVV4 GCCAAAACAACGATAAGCACGCC Cloning of sipVV5 GGATTCATGCTGATTCCTTCGAC Cloning of sipVV6 ACTTGGCACTACACCGCACCTCATGCG Cloning of sipVV7...

Tài liệu Báo cáo khoa học: Molecular cloning and characterization of soybean protein disulﬁde isomerase family proteins with nonclassic active center motifs pdf

... processing), and GmPDIL-1 and GmPDIL-2 associate with proglycinin and b-con-glycinin in the ER, suggesting that they may playimportant roles in folding and in formation and rearrangement of disulﬁde ... synthesis levels of both b-conglycinin and glycinin,as pro-b-conglycinin and proglycinin are transient pro-tein forms that are present in the ER prior to process-ing in the protein storage vacuoles. ... The synthesis of proglycinin and pro-b-conglycinin was initiated whenthe seeds achieved a mass of 50 mg (Fig. 5A, lanes 2 and 4). The amount of GmPDIL-3a and GmPDIL-3bproteins increased until...

Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx

... observed in the presence of hep-arin (Fig. 6A) indicating that the mechanism of reiniti-ation operates in RNA synthesis using both the plus and the minus 3¢-ends of HCV RNA as templates.Finally, ... amount of radioactivity incorporated into the nucleic acids was measuredafter TCA precipitation and plotted against the incubation time in minutes.T. Astier-Gin et al. Binding and replication of ... Secondary struc-ture of a fragment spanning from nt 229–341 in domain II (predicted byRNA DRAW soft-ware).Binding and replication of 3¢-end of HCV minus RNA T. Astier-Gin et al.3874 FEBS Journal...

Xem thêm

Từ khóa: tài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdf tài liệu báo cáo nghiên cứu khoa học tài liệu về báo cáo khoa học báo cáo khoa học công nghệ phục vụ nông nghiệp và phát triển nông thôn các tỉnh phía bắc 2006 2007 tài liệu phục vụ hội nghị báo cáo khoa học tài chính công báo cáo khoa học số loài quý hiếm tại vườn quốc gia ba bể Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại Một số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTP Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng Thơ nôm tứ tuyệt trào phúng hồ xuân hương Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khí Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015 TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ