0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Tài liệu Báo cáo khoa học: "Beefmoves: Dissemination, Diversity, and Dynamics of English Borrowings in a German" ppt

Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Beefmoves: Dissemination, Diversity, and Dynamics of English Borrowings in a German" ppt

... LinguisticsBeefmoves: Dissemination, Diversity, and Dynamics of English Borrowings in a German Hip Hop ForumMatt GarleyDepartment of LinguisticsUniversity of Illinois707 S Mathews AvenueUrbana, IL 61801, USAmgarley2@illinois.eduJulia ... classi-fier, using character 1- through 6-grams (includingword boundaries) as features. Since we could notmanually annotate a large portion of the MZEE cor-pus, the training data consisted of ... 0.32Table 1: Type- and token-based precision at recall=95from commonly-affixed stems in the MZEE corpus and a German grammar (Fagan, 2009).Compound-cutting Nominal and adjectival com-pounding...
  • 5
  • 537
  • 0
Tài liệu Báo cáo khoa học: Activation loop 3 and the 170 loop interact in the active conformation of coagulation factor VIIa pdf

Tài liệu Báo cáo khoa học: Activation loop 3 and the 170 loop interact in the active conformation of coagulation factor VIIa pdf

... precisely, anFig. 4. N-terminal pegylation of G37 2A- FVIIa and FVIIa. (A) Pegyla-tion of free and TF-bound G37 2A- FVIIa and FVIIa visualized bySDS–PAGE. At each time point, a 12 lL aliquot of the reaction ... boundboth variants with the same affinity, and incorporation of an active site inhibitor into FVIIa and G37 2A- FVIIa increased the affinity for sTF in an indistin-guishable manner. The differences and ... con-taining 0.1 m NaCl, 5 mm CaCl2 and 1 mgÆmL)1bovineserum albumin and monitored as described above. Theamidolytic activity of G37 2A- FVIIa and FVIIa was mea-sured by incubating G37 2A- FVIIa...
  • 11
  • 619
  • 0
Tài liệu Báo cáo khoa học: Substrate specificity and inhibition of brassinin hydrolases, detoxifying enzymes from the plant pathogens Leptosphaeria maculans and Alternaria brassicicola ppt

Tài liệu Báo cáo khoa học: Substrate specificity and inhibition of brassinin hydrolases, detoxifying enzymes from the plant pathogens Leptosphaeria maculans and Alternaria brassicicola ppt

... variety of crops cultivated around the world,including the oilseeds rapeseed and canola (Bras-sica napus and Brassica rapa) and vegetables such asecabbage (Brassica oleraceae var. capitata), ... Pedras, Zoran Minic and Vijay K. Sarma-MamillapalleDepartment of Chemistry, University of Saskatchewan, Saskatoon, CanadaIntroductionCrucifers (family Brassicaceae, syn. Cruciferae) include a ... brassinin (0.10 mm final concentration) and the known phytoalexins brassicanal A, erucalexin,rutalexin, brassilexin, cyclobrassinin and camalexin(0.10 and 0.30 mm final concentrations). The phyto-alexin...
  • 17
  • 595
  • 0
Tài liệu Báo cáo khoa học: Identification, sequencing, and localization of a new carbonic anhydrase transcript from the hydrothermal vent tubeworm Riftia pachyptila docx

Tài liệu Báo cáo khoa học: Identification, sequencing, and localization of a new carbonic anhydrase transcript from the hydrothermal vent tubeworm Riftia pachyptila docx

... and F. scutaria larvae sequences have a H64 also shared by A. gambiae, A. aegypti, T. gigas,D. melanogaster-2 and D. melanogaster-3 sequences(data not shown). By contrast, R. pachyptila aminoacid ... 710–728RpCAtrRq a TCA CAA ATG TCC AGT GCC AGT T 757–778Full-length sequencing of RpCAbrRpCAbrF TAC AAG GAT GCC ATT AGC 613–630RpCAbrR1 CGT AGC AGT ATC AGC AGT 822–839RpCAbrR2 AGA GCA GCA GAC CTT ACG 706–723RpCAbrR3 ... 706–723RpCAbrR3 GTT ACT TCC GCA GCT AGG 466–483Probe amplification for FISHRpCAbrF TAC AAG GAT GCC ATT AGC 613–630RpCAbrR1 CGT AGC AGT ATC AGC AGT 822–839RpCAtrFprobe TAC AAA GAT CCA ATC CAG C...
  • 14
  • 591
  • 0
Tài liệu Báo cáo khoa học: ATP-dependent modulation and autophosphorylation of rapeseed 2-Cys peroxiredoxin docx

Tài liệu Báo cáo khoa học: ATP-dependent modulation and autophosphorylation of rapeseed 2-Cys peroxiredoxin docx

... promoter of pET-22b(+) vector] as 5¢-primer and 5¢-TCTCCGTAGGGGAGACAAAAGT-3¢,5¢-ATCCCGCGGGGGAAACCTCATC-3¢ and 5¢-CTGTTTGGACGAACGCAAGATG-3¢as 3¢-primers for C53S, C175S and W88F variants, respec-tively ... (A) Expanded view of peaks at m ⁄ z 2800.36 and 2832.35 and the fragmentation of the peak at m ⁄ z 2800.36. (B) Expanded view of peaks atm ⁄ z 2934.36 and 2950.35 and the fragmentation of the peak ... addition of EGTA to a final concentration of 5 mM, theprotein solution was further incubated for 5 min and the peroxidase activity was assayed as in (A) . (D) Effect of ATP and Mg2+on the chap-erone...
  • 14
  • 460
  • 0
Tài liệu Báo cáo khoa học: Preliminary molecular characterization and crystallization of mitochondrial respiratory complex II from porcine heart ppt

Tài liệu Báo cáo khoa học: Preliminary molecular characterization and crystallization of mitochondrial respiratory complex II from porcine heart ppt

... Tsukihara T, Aoyama H, Yamashita E, Tomizaki T,Yamaguchi H, Shinzawa-Itoh K, Nakashima R, YaonoR & Yoshikawa S (1995) Structures of metal sites of oxidized bovine heart cytochrome c oxidase at ... 140 amino acids, and CybS, 11 kDa, 103 amino acids) with a total of sixtransmembrane helices. Here we provide a detailedreport of the preparation, gene sequencing, N-terminalsequencing and ... at 2.8 A. Science 269, 1069–1074.14 Tsukihara T, Aoyama H, Yamashita E, Tomizaki T,Yamaguchi H, Shinzawa-Itoh K, Nakashima R, YaonoCharacterization of respiratory complex II X. Huo et al.1528...
  • 6
  • 469
  • 0
Tài liệu Báo cáo khoa học: Unusual metal specificity and structure of the group I ribozyme fromChlamydomonas reinhardtii23S rRNA pptx

Tài liệu Báo cáo khoa học: Unusual metal specificity and structure of the group I ribozyme fromChlamydomonas reinhardtii23S rRNA pptx

... Plasmid pGEM23S.5 contains a shortened intron (380 bp), 26 bp of the 5¢ exon, and 25 bp of the 3¢ exon. Oligo 104 (45 nucleotides, TAATACGACTCACTATAGGGATCGAATTCTGGGTTCAAAACGTAA)contains, in ... A expðÀk a  tÞþB expðÀkb tÞð2Þ A and k a are the percentage and observed rate constant forthe fast-reacting pre-RNA, and B and kbare the sameparameters for the slow fraction; t is reaction ... of a novel base-pairing interaction in group I introns.Genes Dev 4, 777–788.46 Ikawa Y, Shiraishi H & Inoue T (2000) Minimal cataly-tic domain of a group I self-splicing intron RNA.Nature...
  • 14
  • 480
  • 0
Tài liệu Báo cáo khoa học: Physico-chemical characterization and synthesis of neuronally active a-conotoxins docx

Tài liệu Báo cáo khoa học: Physico-chemical characterization and synthesis of neuronally active a-conotoxins docx

... are ambiguitiesarising from, for example, asparagine to aspartic acid, orglutamine to glutamic acid changes [14]. The a- conotoxinsEpI, PnIA, GIC, GID, AnIA and AnIB contain pairs of asparagine ... and MS, including identification of post-translational modificationsIsolation and identificationStandard procedures for identification and isolation of a- conotoxins generally incorporate separations ... [38].Characterization of the sulfotyrosine-containing a- cono-toxin EpI was undertaken by a combination of massspectrometry and modified amino acid analysis [24]. Theconotoxins a- PnIA and a- PnIB from...
  • 11
  • 554
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Extracting Comparative Entities and Predicates from Texts Using Comparative Type Classification" pptx

... Mining comparative entities and predicates (Task 2): Our basic idea for the second task is selecting candidates first and finding answers from the candidates later. We regard each of noun ... represented as a combination of their lexicalization and POS tag. After feature generation, we calculate each probability value of all CE-candidates using SVM. For example, if a sentence has three ... defining the syntax and semantics of comparative constructs. Ha (199 9a; 1999b) classified the structures of Korean comparative sentences into several classes and arranged comparison-bearing...
  • 9
  • 405
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Using Automatically Transcribed Dialogs to Learn User Models in a Spoken Dialog System" doc

... training sets of varying sizes, as wellas a test set of 1000 dialogs. Each generated dialogd in each training/test set consisted of a sequence of values for all the observed and unobserved variables:d ... corpora are usu-ally small and sparse. In this work, we propose a method of building user models that does not oper-ate on manually transcribed dialogs, but instead usesdialogs that have been transcribed ... t that˜ A t= a and St= s.For each training set D, we estimated θ using thefollowing three methods:1. Manual: Let θ be the maximum likelihoodestimate using manually transcribed data, i.e.,θasu=KDasuP a KDasu.2....
  • 4
  • 470
  • 0

Xem thêm

Từ khóa: tài liệu báo cáo nghiên cứu khoa họctài liệu về báo cáo khoa họcbáo cáo khoa học tài chính côngbáo cáo khoa học số loài quý hiếm tại vườn quốc gia ba bểtai lieu bao cao thuc tap khoa co khitai lieu bao cao thuc tap tai khoa duoc benh vienNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)MÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ