Tài liệu Báo cáo khoa học: Temperature and phosphate effects on allosteric phenomena of phosphofructokinase from a hibernating ground squirrel (Spermophilus lateralis) pptx
Tài liệu Báo cáo khoa học: Temperature and phosphate effects on allosteric phenomena of phosphofructokinase from a hibernating ground squirrel (Spermophilus lateralis) pptx
... Temperature and phosphate effects on allosteric phenomena of phosphofructokinase from a hibernating ground squirrel (Spermophilus lateralis) Justin A. MacDonald1 and Kenneth B. ... increasing the pH slightly to a value of 7.3 dramatically altered the effect of phosphate and activation was seen only at low concentrations with a maximal 1.7-fold activation at 2 mm phosphate. AtTable ... anomalousinteraction between pH and phosphate effects on theenzyme. At pH 7.0, phosphate acted as a strong acti-vator of PFK and raised maximal activity by 5.1-fold.The calculated K a for phosphate was...
- 9
- 579
- 0
Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt
... (CATATGGCTAGCATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCGTGCCAACTCCCAC) containing a BamHI site. The genewas cloned at the NheI and BamHI sites of ... forphosphorus scavenging and remobilization when thecells are under stress and consequently mononucleotide phosphate concentrations are high.Materials and methodsCloning and purification of St SurEThe ... S, Khachatr-yan A, Vyas S, Arrowsmith CH, Clarke S, Edwards A, Joachimiak A et al. (2001) Structure of Thermotogamaritima stationary phase survival protein SurE: a novel acid phosphatase. Structure...
- 10
- 553
- 0
Tài liệu Báo cáo khoa học: Compartmentalization and in vivo insulin-induced translocation of the insulin-signaling inhibitor Grb14 in rat liver pptx
... grade) was from Collaborative Bio-medical (Bedford, MA, USA). Monoclonal and polyclonalantibodies against IRb, polyclonal antibodies against EGF and polyclonal antibodies against Grb7 were from ... antibody against EEA1 (clone 14) was from BD Transduction Laboratories (San Jose, CA, USA).Monoclonal antibody against Na+⁄ K+-ATPase a- subunit(clone M7-PB-E9) and polyclonal antibodies against ... immunoreactiveGrb14 was examined using preparative and analyticalfractionation and compared to that of the IR. Upondifferential centrifugation (Fig. 1A) , Grb14 was detect-able as a major protein...
- 15
- 497
- 0
Tài liệu Báo cáo khoa học: Unfolding and aggregation during the thermal denaturation of streptokinase pptx
... high temperatures with the formation of highmolecular mass aggregates of SK. The maximum degree of aggregation occurs at high sample concentrations and attemperatures where domain A unfolds, and ... reversiblebecause state A ncan dissociate and unfold at hightemperatures. Nevertheless, association and dissociationcan be slow at certain temperatures and therefore kineticallycontrolled. Constants ... Thispeakalsobecomesnarrowerandhasasmallerareathanthesingle two-state unfolding transition observed at a concen-tration of 0.88 mgÆmL)1. The partial development of denaturation heat suggests...
- 13
- 503
- 0
Báo cáo khoa học: Temperature and salts effects on the peptidase activities of the recombinant metallooligopeptidases neurolysin and thimet oligopeptidase pdf
... and salt concentration. The relative amount of cleavage variedwith the nature of the substitution at the X position aswell as with temperature and NaCl concentration. TOPwas activated by all ... tononlinear least square plot of Eqn (1). The overall Vmaxwasobtained from Eqn (1), whereas the separate values forV a max and Vbmaxwere calculated using the ratio of the areastaken from ... influence of NaCl concentration on kcat/Kmvalues of TOP and neurolysin activities on the peptides containingAla, Val, Asp and Ile at the X position in the series Abz-GGFLRRXQ-EDDnp was examined...
- 9
- 558
- 0
Tài liệu Báo cáo khoa học: Applications and trends in systems biology in biochemistry docx
... isthe only activity able to convertpyruvate into acetyl-CoA. Tworedundant pathways for acetateassimilation are needed as a result of a coupling between the TCA cycle and acetate activation to acetyl-CoAby ... level is a key regulator of the rate of mitochondrialrespiration in the heart allowing ATP and creatine phosphate levels tomaintain relatively constant over a large range of cardiac work rateODE ... (ischemia) of key metaboliteconcentrations and metabolic fluxes,both measured and nonmeasured. A general parameter sensitivityanalysis is carried out to determine and characterize the parametershaving...
- 91
- 733
- 0
Tài liệu Báo cáo khoa học: Structure and function of active chromatin and DNase I hypersensitive sites pdf
... Georgiou A, Szutorisz H, Maia e Silva A, Pombo A, Barahona I, Dargelos E, Canzonetta C &Dillon N (2005) Variant histone H3.3 marks promot-ers of transcriptionally active genes during mammaliancell ... cyclical process is accompanied bytransient sequential histone acetylation and deacetyla-tion, and transient recruitment of remodellers and transcription factors. A cycle of transcription commences ... typically recruitHATs such as SAGA and NuA3, which mainly acety-late histone H3, and NuA4 which acetylates histone H4 on K5, K8 and K12. This cascade of events leads torecruitment of transcription...
- 29
- 743
- 0
Tài liệu Báo cáo khoa học: miRNAs and regulation of cell signaling pptx
... UGUUGUUUUAGUGAUCAGAAGGUGY-box family miRNABrd-box: 5´ AGCUUUA |||||||dme-miR-4 3´ AGUUACCAACAGAUCGAAAUAdme-miR-79 3´ UACGAACCAUUAGAUCGAAAUABrd-box family miRNAsK-box: 5´ cUGUGAUa ||||||dme-miR- 2a ... cycleCell survivalmiR-278Site1:Expanded UTR 5´ AAAUGUAAACGAAAA-CCCACCGU ||||| |||||| ||||||| dme-miR-278 3´ UUUGCC UGCUUUCAGGGUGGCUsite2:Expanded UTR 5´ AGAUGGUAAAAUACACGAG CCACUGA ||:||| ... AUGCUAAAUCCGCUUCAGUAUUU ||||||| hsa-miR-200b 3´ AGUAGUAAUGGUCCGUCAUAAUhsa-miR-200c 3´ AGGUAGUAAUGGGCC-GUCAUAAUTGF- s/BMPsR-smadspri-miR-21,19 9a pre-miR-21,19 9a DroshaDGCR8p68SignalMAPKKKERKmiR-21Spry1,...
- 9
- 684
- 0
Tài liệu Báo cáo khoa học: MicroRNAs and epigenetics doc
... understanding of diseases.Materials and methodsTyping of miRNAs by positional relationship tomRNA transcriptsInformation about the localization and strand direction of 939 miRNAs, 35245 Refseq genes and ... excluded from the Refseq data set.Using matlab, version 201 1a (Mathworks, Natick, MA,USA), we compared localization and strand directionbetween miRNAs and transcripts (Refseq genes and mRNAs). ... HDAC-1,whereas Bcl-6, Stat3 and YY1 are targeted by HDAC-2. By regulating both histone and nonhistone proteins,HDACs 1 and 2, classified as class I HDACs, areimplicated in cell proliferation, apoptosis...
- 12
- 636
- 0
Tài liệu Báo cáo khoa học: MicroRNAs and cardiovascular diseases ppt
... cardiomyopathies, and heart failure and can be defined as an inappropriate accumulation of extracellular matrix proteins in the heart [69–74]. Car-diac fibrosis leads to an increased mechanical ... sarcoplasmic reticulumjunction, and are activated by membrane depolariza-tion. IcaLis important in heart function because itmodulates action potential shape and contributes topacemaker activities ... insulin-medi-ated activation of Srebp-1c transcription and stimula-tion of fatty acid synthesis in liver. Proc Natl Acad SciUSA101, 11245–11250.K. Ono et al. MicroRNAs and cardiovascular diseasesFEBS...
- 15
- 684
- 0
Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansThơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ