Tài liệu Báo cáo khoa học: An alternative transcript from the death-associated protein kinase 1 locus encoding a small protein selectively mediates membrane blebbing pdf
Tài liệu Báo cáo khoa học: An alternative transcript from the death-associated protein kinase 1 locus encoding a small protein selectively mediates membrane blebbing pdf
... integrin-mediated polarity pathway.J Cell Biol 17 2, 619 –6 31. 10 Inbal B, Bialik S, Sabanay I, Shani G & Kimchi A (2002) DAP kinase and DRP -1 mediate membrane blebbing and the formation of autophagic ... lower protein band was observed in the Flag–s-DAPK -1- and the Flag–s-DAPK -1- Myc-transfected cells, whereas the upper band in the Flag–s-DAPK -1 transfection lane was slightly smaller(Fig. 2C, lane ... DAPK- 1 and induce membrane blebbing. A function was alsoattributed to the unique tail of s-DAPK -1: it can regu-late the localization and half-life of the protein andFig. 4. The C-terminal...
- 11
- 659
- 0
Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc
... NA TGCARRAAYATHTTYTCCAGDeg RPE65-Rev AYRAAYTCRWRBCCYTTCCARPE6 5a- FwdNM_2007 51 GCGGCCGCCACCATGGTCAGCCGTTTTGAACACRPE6 5a- Rev GATATCTTATGGTTTGTACATCCCATGGAAAGRPE65c-FwdNM_0 011 13653 GCGGCCGCCACCATGGTCAGCCGTCTTGAACACRPE65c-Rev ... GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTTTTGAACACRPE65c-His-FwdNM_0 011 13653 GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTCTTGAACACY. Takahashi et al. A novel isomerohydrolase in the retinaFEBS Journal 278 (2 011 ) 2 913 –2926 ... CTGAGGTTACAGACAACTGTTC 13 cIMH GSP-Rev CCTTTGACATCGCAAGTGGATCARPE65c GSP-FwdNM_0 011 13653 TTGAGGTGACAGACAATTGCCTRPE65c GSP-Rev TCTTTGACTTCTCAAACTGATCGRPE6 5a- His-FwdNM_2007 51 GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTTTTGAACACRPE65c-His-FwdNM_0 011 13653...
- 14
- 753
- 0
Tài liệu Báo cáo khoa học: "An alternative LR algorithm for TAGs" docx
... correctly. The language de- scribed by the grammar contains exactly the strings abc, a& apos;b'c ~, adbec, and a& apos;db'ecq The al- gorithm from Schabes and Vijay-Shanker (19 90) however also ... straightforward way to correct the algorithm. We therefore developed an alternative to the algorithm from Schabes and Vijay-Shanker (19 90). This alternative is novel in presenta- tional aspects, ... X to range over elements from A4 . A configuration (A, w) of the automaton con- sists of a stack A • $ and a remaining input w. The steps of the automaton are given by the bi- nary relation...
- 7
- 413
- 0
Tài liệu Báo cáo khoa học: "An Alternative Conception of Tree-Adjoining Derivation*" ppt
... Schabes. 19 91. Computational and mathematical studies of lexicalized grammars. Manuscript in preparation based on the author's PhD dissertation (University of Pennsylvania, August 19 90). ... seen in that any adjunetion of/32 at a node at which an adjunction of/ 31 occurs could instead be replaced by an adjunction of/32 at the root of/ 31. The advantage of this standard definition ... have not taken full ad- vantage of this decoupling, and are not as appro- priate as they might be for the kind of further analysis that tree-adjoining analyses could make possible. In particular,...
- 10
- 338
- 0
Tài liệu Báo cáo khoa học: An autoinhibitory effect of the homothorax domain of Meis2 ppt
... within the Hth domain that weaken interaction with Pbx1 [35]. An interaction between Prep1 and the transcriptionalrepressor p160Mybbp1 has been mapped to the Prep1Hth domain, and specifically to a ... Santa Clara, CA, USA). For quantitative RT-PCR,cDNA was generated using Superscript III (Invitrogen), andanalyzed by PCR using a DNA engine cycler and PromegaTaq. Intron-spanning primer pairs ... fusion proteins, which contain an nuclear localization signal within the GBD part of the protein. Another possible explanation for the observedautoinhibitory activity is that the Hth domain mediates some...
- 14
- 753
- 0
Tài liệu Báo cáo khoa học: An intermediate step in the evolution of ATPases – a hybrid F0–V0 rotor in a bacterial Na+ F1F0 ATP synthase pdf
... hasonly 10 membrane- buried negative charges that areessential for binding the ion and also for the rotationalmechanism of the ring. The c ring of I. tartaricus has 11 negative charges that ... synthase from A. woodii. Samples of isolated enzyme(lane 1) and isolated c rings (lanes 3, 4 and7) were boiled at 80 °C for 20 min andapplied to a 10 .0% (lanes 1 3) or 13 .5%(lanes 4–9) polyacrylamide ... ion flow across the membrane [4–6].Subunit c of the F 1 F0ATP synthases has a molecularmass of approximately 8 kDa, and folds in the mem-brane like a hairpin, with two transmembrane helicesconnected...
- 9
- 773
- 0
Tài liệu Báo cáo khoa học: "An Experiment in Evaluating the Quality of Translations" pdf
... telligibility ratings of the 14 4 sentences in each of six trans- lations. Translations 1, 4, and 2 are human translations; Translations 7, 5, and 9 are machine translations. EVALUATING THE QUALITY ... TRANSLATIONS 61 mean that the raters agree reliably that the sentences selected from a given passage in a given translation differ substantially, and further, that for any given passage, the ... one had a set of sentences produced by a given translation source a given human translator or a particular machine-translation program—and one wanted to obtain a mean rating for this translation...
- 12
- 550
- 0
Tài liệu Báo cáo khoa học: Crystal structure of Klebsiella sp. ASR1 phytase suggests substrate binding to a preformed active site that meets the requirements of a plant rhizosphere enzyme doc
... substrate-freeAppA the C a atoms are 2. 41 A ˚apart, whereas for the substrate-free PhyK and the substrate-loaded AppA the averaged distance is only 1. 87 A ˚.Distinct conformational changes ... phytate with pH optima in the acidic range. They consist of two domains, a large a ⁄ bdomain and a small a domain with the catalytic site at the interface of the two domains [4,5]. HAPs can initi-ate ... density maps and the location of errors in thesemodels. Acta Crystallogr A 47, 11 0 11 9.32 Nayal M & Di Cera E (19 96) Valence screening ofwater in protein crystals reveals potential Na+bindingsites....
- 13
- 766
- 0
Tài liệu Báo cáo khoa học: Fatty acid desaturases from the microalga Thalassiosira pseudonana pptx
... of a range of potential fatty acid substrates (18 :2D9 ,12 , 18 :3D9 ,12 ,15 , 20:2D 11, 14, 20:3D 11, 14 ,17 , 20:3D8 ,11 ,14 ,20:4D8 ,11 ,14 ,17 , 22:4D7 ,10 ,13 ,16 , 22:5D7 ,10 ,13 ,16 ,19 ) of desatu-rases ... 20:3D8 ,11 ,14 and 20:4D8 ,11 ,14 ,17 (A) , 20:3D 11, 14 ,17 (B), and20:2D 11, 14(C) exogenously fed before sampling for fatty acid analy-sis. New fatty acids are underlined. The experiment was repeatedtwice ... (LCPUFAs). The most prominent of theseare the health beneficial omega-3 eicosapentaenoic acid(EPA, 20:5D5,8 ,11 ,14 ,17 ) and docosahexaenoic acid(DHA, 22:6D4,7 ,10 ,13 ,16 ,19 ). Among the alga groups...
- 12
- 618
- 0
Tài liệu Báo cáo khoa học: An anthrax lethal factor mutant that is defective at causing pyroptosis retains proapoptotic activity pdf
... immunoprecipitation.S. Ngai et al. An LF mutant with altered activityFEBS Journal 277 (2 010 ) 11 9 12 7 ª 2009 The Authors Journal compilation ª 2009 FEBS 12 1pro-IL-1b in the cytosol and the appearance ... distinct mechanisms. Proc Natl Acad Sci USA 10 5,4 312 –4 317 . 16 Wickliffe KE, Leppla SH & Moayeri M (2008)Anthrax lethal toxin-induced inflammasome formationand caspase -1 activation are late events ... experiments. An LF mutant with altered activity S. Ngai et al. 12 2 FEBS Journal 277 (2 010 ) 11 9 12 7 ª 2009 The Authors Journal compilation ª 2009 FEBSMAPKK1 and 20% of MAPKK2 being cleaved. As the mutant...
- 9
- 579
- 0
Từ khóa: tài liệu báo cáo nghiên cứu khoa họctài liệu về báo cáo khoa họcbáo cáo khoa học tài chính côngbáo cáo khoa học số loài quý hiếm tại vườn quốc gia ba bểtai lieu bao cao thuc tap khoa co khitai lieu bao cao thuc tap tai khoa duoc benh vienNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ