0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt

Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt

Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt

... Bxe _A2 876 (accession numbergi:91782944) was amplified from genomic DNA of B. xenovo-rans LB400 through a PCR with GAGCGGCATATGGAAATCAAACCGAAGGTTCGCGA and GAGCGGCATATGGAAATCAAACCGAAGGTTCGCGA ... Meyer-Klaucke for data collection and assis-tance in data evaluation. The assistance of T. Pavkov(Institute of Chemistry, University of Graz) in theacquisition of CD and DLS data is gratefully acknowl-edged. ... Kuczewski and H. Wiltsche (Institute of Analytical Chemistry and Radiochemistry, Graz Uni-versity of Technology) are thanked for metal analysis.G. D. Straganz acknowledges support from the Aus-trian...
  • 15
  • 624
  • 0
Tài liệu Báo cáo khoa học: Crystal structure of an ascomycete fungal laccase from Thielavia arenaria – common structural features of asco-laccases ppt

Tài liệu Báo cáo khoa học: Crystal structure of an ascomycete fungal laccase from Thielavia arenaria – common structural features of asco-laccases ppt

... ascomycete fungal laccase from Thielavia arenaria – common structural features of asco-laccasesJuha P. Kallio1, Chiara Gasparetti2, Martina Andberg2, Harry Boer2, Anu Koivula2, Kristiina Kruus2,Juha ... observed for MaL, that may determinethe properties of these asco-laccases at high protein concentrations.DatabaseStructural data are available in the Protein Data Bank database under the accession ... Paloheimo M, Valtakari L, Puranen T, Kruus K, KallioJ, Ma¨ntyla¨ A, Fagerstro¨m R, Ojapalo P & Vehmaan-pera¨J (2006) Novel laccase enzyme and use thereof.European patent application WO...
  • 13
  • 888
  • 0
Tài liệu Báo cáo khoa học: Molecular characterization of Arabidopsis thaliana PUF proteins – binding specificity and target candidates doc

Tài liệu Báo cáo khoa học: Molecular characterization of Arabidopsis thaliana PUF proteins – binding specificity and target candidates doc

... functionugcgucugacaUGUACAGCcccugccaaauuuuaauaggcaatAGUAAAUAaauaacgacaagaagcaaauggAt5g24490 (1) Ribosomal protein; unknown function cucaucucuccuuacaguuuaccuguguaggaguuaggguucuugaauaaacaaugcaacaaagauuguagaagucagUGUACAUAAt4g36040 ... and5¢-GTCAAACATTTCTCAACAACGTGTGAAGCAAACTTCTGTTGG-3¢ (reverse) to APUM-2 and 5¢-CGATGCAGAAATTCAGTAGCAACATGGTGGAACGATGTCTCA-3¢ (forward) and 5¢-GCATGAGACATCGTTCCACCATGTTGCTACTGAATTTCTGCA-3¢ (reverse) ... cucaucucuccuuacaguuuaccuguguaggaguuaggguucuugaauaaacaaugcaacaaagauuguagaagucagUGUACAUAAt4g36040 (1) Protein containing DNAJ domain;unknown functioncuacgucggacggaacugggaaaccgaucaguguugguagugaguuaacucggugaccgaguuaguagaacgaguuaauuagUGUAAAUAcgaagccaAt4g39090 (1)...
  • 15
  • 586
  • 0
Tài liệu Báo cáo khoa học: Kinetic characterization of the first step of the ribozyme-catalyzed trans excision-splicing reaction docx

Tài liệu Báo cáo khoa học: Kinetic characterization of the first step of the ribozyme-catalyzed trans excision-splicing reaction docx

... estimated by comparing the observed rateconstant of a catalyzed reaction with that of an equivalent uncatalyzed reaction. Under simulatedphysiological conditions, the uncatalyzed rate constant of ... individual steps of RNA-catalyzed reactions through the establishment of kinetic frameworks [6–19]. This approach has beenmechanistically informative and has greatly advancedour understanding of ... true rate constant for theactual chemical step is being masked, probably by a local conformational change that occurs after substratebinding and before the actual chemical step, this rateis approximately...
  • 13
  • 761
  • 0
Tài liệu Báo cáo khoa học: Functional studies of active-site mutants from Drosophila melanogaster deoxyribonucleoside kinase Investigations of the putative catalytic glutamate–arginine pair and of residues responsible for substrate specificity docx

Tài liệu Báo cáo khoa học: Functional studies of active-site mutants from Drosophila melanogaster deoxyribonucleoside kinase Investigations of the putative catalytic glutamate–arginine pair and of residues responsible for substrate specificity docx

... Q81N-fwd:5¢-TGGGCCATGCCCTTTAACAGTTATGTCACGCTG-3¢. Q81N-rev:5¢-CAGCGTGACATAACTGTTAAAGGGCATGGCCCA-3¢. R105H-fwd:5¢-GCTAAAAATAATGGAGCACTCCATTTTTAGCGCTCGC-3¢ . R105H-rev:5¢-GCGAGCGCTAAAAATGGAGTGCTCCATTATTTTTAGC-3¢. ... R105H-rev:5¢-GCGAGCGCTAAAAATGGAGTGCTCCATTATTTTTAGC-3¢. R105K-fwd:5¢-GCTAAAAATAATGGAGAAATCCATTTTTAGCGCTCGC-3¢. R105K-rev:5¢-GCGAGCGCTAAAAATGGATTTCTCCATTATTTTTAGC-3¢Sequence verificationPlasmids of the seven mutants were transformed ... than for dThd and dCyd.Overall, changing Y70 to W had a greater impact oncatalytic efficiency (kcat⁄ Km) with the natural substratesthan with the analogues. Q81N had an increased Kmvalue...
  • 10
  • 504
  • 0
Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx

Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx

... absorption bands. Heme catabolism byHOs of mammals, pathogenic bacteria, cyanobacteriaand probably insects is considered to have a similarmechanism, because the characteristic absorptionbands of verdoheme ... T, Zhang X, Sun D,Sato M, Sasahara M, Kayama T, Ikeda-Saito M &Yoshida T (2000) Histidine 20, the crucial proximalaxial heme ligand of bacterial heme oxygenase Hmu O from Corynebacterium ... degradation rate of GmHO-1, indi-cated in Table 4, is comparable to that of SynHO-1 inthe presence of NADPH, FNR, and Fd, and also to that of rHO-1 in the presence of NADPH and CPR.Here, NADPH...
  • 16
  • 617
  • 0
Tài liệu Báo cáo khoa học: Thermodynamic characterization of interleukin-8 monomer binding to CXCR1 receptor N-terminal domain ppt

Tài liệu Báo cáo khoa học: Thermodynamic characterization of interleukin-8 monomer binding to CXCR1 receptor N-terminal domain ppt

... DASApolarare the changes inASA of the apolar and polar residues, respectively[39]. The structure-based calculations provide a DCp of )407 calÆmol)1ÆK)1and DASAapolarand DASApolar of )1354 and ... experiment-ally determined structures are a snapshot of one of many conformations that a protein can adopt, and that proteins undergo a variety of fast and slowmotions [42]. For instance, NMR relaxation ... mutant which exists as a monomer. Calori-metry data indicate that the binding is enthalpically favored and entropical-ly disfavored, and a negative heat capacity change indicates burial of hydrophobic...
  • 11
  • 549
  • 0
Tài liệu Báo cáo khoa học: Biochemical characterization of human 3-methylglutaconyl-CoA hydratase and its role in leucine metabolism docx

Tài liệu Báo cáo khoa học: Biochemical characterization of human 3-methylglutaconyl-CoA hydratase and its role in leucine metabolism docx

... their absorbance at 260 nm. Peak 3 produced small amounts of HMG-CoA and large amounts of free CoA. Peak 4 produced HMG-CoA and also large amounts of free CoA. Peak 5 produced large amounts of HMG-CoA, ... revealed a 32 kDa AUH protein and it was thus assumed that the mature form of human AUH in brain has a molecular weight of 32 kDa (AUHp32) [15]. For thekinetic characterization of AUH described ... Synthesis wasstarted by addition of 0.25 mg glutaconate-CoA-transferase from A. fermentans. The reaction was analyzed by HPLC and the CoA deriva-tives were detected by their absorbance at 260 nm....
  • 11
  • 625
  • 0
Tài liệu Báo cáo khoa học: Biochemical characterization of Bacillus subtilis type II isopentenyl diphosphate isomerase, and phylogenetic distribution of isoprenoid biosynthesis pathways doc

Tài liệu Báo cáo khoa học: Biochemical characterization of Bacillus subtilis type II isopentenyl diphosphate isomerase, and phylogenetic distribution of isoprenoid biosynthesis pathways doc

... chromosome was amplified byPCR using chromosomal B. subtilis DNA as template andthe oligonucleotides 5¢-TTGGTGGGATCCGTGACTCGAGCAGAACGAAAAAGAC-3¢ and 5¢-GGCTTTGTCGACTTATCGCACACTATAGCTTGATG-3¢ as primers(restriction ... humanpathogens.Enterococci and Staphylococci have a dramatic history of resistance development against virtually all currently avail-able antibiotics. Most notably, many strains are multidrugresistant, and the rapidly ... isopentenyl diphosphate isomerases were found in thegenomes of Archaea and of certain eubacteria but not inthe genomes of fungi, animals and plants. The analysis of theoccurrence of idi-1 and idi-2...
  • 12
  • 692
  • 0
Tài liệu Báo cáo khoa học: Functional analysis of the basic helix-loop-helix transcription factor DEC1 in circadian regulation ppt

Tài liệu Báo cáo khoa học: Functional analysis of the basic helix-loop-helix transcription factor DEC1 in circadian regulation ppt

... 5¢-AAGCTTCACCATGTACCCTGCCCACATGTACCAAGTGTAC-3¢,5¢-AAGCTTCACCATGCCGCACCGG CTCATCGAGAAAAAGAG-3¢,5¢-AAGCTTCACCATGGCAGTGGTTCTTGAACTTACCTTGAAGC-3¢ or5¢-AAGCTTCACCATGATTGCCCTGCAGAGTGGTTTACAAGCTG-3¢) were used. Amplified ... and5¢-GCAGCAGGATCCTCTAGAGAGTTTAGTCTTTG-3¢ for FLAG-DEC1; and 5 ¢-GAATTCGGCGGACCAGAGAATGGACATTTCCTCAACCATC-3¢ and5¢-TCTAGACTACAGCGGCCATGGCAAGTCACTAAAGTC-3¢ for FLAG-BMAL1) were used for amplificationby ... primers(5¢-CGGCAATTTGTAGGTCTCCTTGCTGTCCTCGCTC-3¢ and 5¢-GCCCGGCTCATCGAGAAAAAGAGACGTGACCGG-3¢ for DEC1-H5 7A; 5¢-GATGAGCCGGTGCGGCAATTTGTAGGTCTCC-3¢ and 5 ¢-GAGAAAAAGAGAGCTGACCGGATTAACGAGTGC-3¢ forDEC1-R6 5A, FLAG-DEC1-R6 5A and DEC1:4–232-R6 5A; ...
  • 11
  • 629
  • 0

Xem thêm

Từ khóa: tài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdftài liệu báo cáo nghiên cứu khoa họctài liệu về báo cáo khoa họcbáo cáo khoa học công nghệ phục vụ nông nghiệp và phát triển nông thôn các tỉnh phía bắc 2006 2007 tài liệu phục vụ hội nghịbáo cáo khoa học tài chính côngbáo cáo khoa học số loài quý hiếm tại vườn quốc gia ba bểBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Báo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ