0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Tài liệu Báo cáo khoa học: TMPRSS13, a type II transmembrane serine protease, is inhibited by hepatocyte growth factor activator inhibitor type 1 and activates pro-hepatocyte growth factor pdf

Tài liệu Báo cáo khoa học: TMPRSS13, a type II transmembrane serine protease, is inhibited by hepatocyte growth factor activator inhibitor type 1 and activates pro-hepatocyte growth factor pdf

Tài liệu Báo cáo khoa học: TMPRSS13, a type II transmembrane serine protease, is inhibited by hepatocyte growth factor activator inhibitor type 1 and activates pro-hepatocyte growth factor pdf

... haemagglutinin; HAI -1, hepatocyte growth factor activator inhibitor type 1; HAI-2, hepatocyte growth factor activator inhibitor type 2; HGF, hepatocyte growth factor; HGFA, hepatocyte growth factor activator; ... Nagatsuta,Midori-ku, Yokohama, Japan2 Advanced Medical Research Laboratory, Mitsubishi Tanabe Pharma Corporation, Kamoshida-cho, Aoba-ku, Yokohama, JapanIntroduction Type II transmembrane serine ... 257–2 61. 25 Miyazawa K, Tsubouchi H, Naka D, Takahashi K,Okigaki M, Arakaki N, Nakayama H, Hirono S, Sakiy-ama O, Takahashi K et al. (19 89) Molecular cloning and sequence analysis of cDNA for...
  • 13
  • 641
  • 0
Tài liệu Báo cáo khoa học: Gene transcription of fgl2 in endothelial cells is controlled by Ets-1 and Oct-1 and requires the presence of both Sp1 and Sp3 pdf

Tài liệu Báo cáo khoa học: Gene transcription of fgl2 in endothelial cells is controlled by Ets-1 and Oct-1 and requires the presence of both Sp1 and Sp3 pdf

... double stranded oligos Oct -1, 5¢-TGTCGAATGCAAATCACTAGAA-3¢; Sp1, 5¢-ATTCGATCGGGGCGGGGCGAGC-3¢; Ets/Pea3, 5¢-GATCTCGAGCAGGAAGTTCGA-3¢; Ets (PU .1) , 5¢-GGGCTGCTTGAGGAAGTATAAGAAT-3¢;Stat3,5¢-GATCCTTCTGGGAATTCCTAGATC-3¢; ... from a pM166 template using a common senseprimer 5¢-GAATAAGGAGGGCAGGGTGAA-3¢ (posi-tions )13 20 to )13 02 in GenBank accession no. AF025 817 ), and the antisense primers 5¢-TAGTGGGGAAAGAGTTGGAACG-3¢ ... TAC AGG AGG AGMu-S)97/) 91 GTG GCG TCT GAG GTA CCA ATG CAA ATG CGCMu-AS)97/) 91 GCG CAT TTG CAT TGG TAC CTC AGA CGC CACMu-S)87/)80 GAG ACT GTG ATG CGG TAC CTC CCG CCC TTT CMu-AS)87/)80 GAA AAG...
  • 13
  • 525
  • 0
Tài liệu Báo cáo khoa học: Erythrochelin – a hydroxamate-type siderophore predicted from the genome of Saccharopolyspora erythraea docx

Tài liệu Báo cáo khoa học: Erythrochelin – a hydroxamate-type siderophore predicted from the genome of Saccharopolyspora erythraea docx

... from bacterial genomics. Nat Prod Rep24, 10 73 11 09.32 Umezawa H, Aoyagi T, Ogawa K, Obata T, Iinuma H,Naganawa H, Hamada M & Takeuchi T (19 85) For-oxymithine, a new inhibitor of angiotensin-convertingenzyme, ... angiotensin-convertingenzyme, produced by actinomycetes. J Antibiot (Tokyo)38, 18 13 18 15.33 Aoyagi T, Wada T, Iinuma H, Ogawa K, Kojima F,Nagai M, Kuroda H, Obayashi A & Umezawa H (19 85) Influence of angiotensin-converting ... erythrochelin.Fig. S10. Fragmentation pattern of C-terminal fragment.Fig. S 11. LC-MS analysis of erythrochelin hydrolysate.Fig. S12. LC-MS trace of FDAA-derivatized standards.Fig. S13. LC-MS trace of FDAA-derivatized...
  • 14
  • 614
  • 0
Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf

Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf

... TransLISA, a novel quantitative, nonradioactive assayfor transcription factor DNA-binding analysesKristiina A. Vuori 1 , Johanna K. Ahlskog2, Lea Sistonen2 and Mikko Nikinmaa 1 1 Centre ... AGCTGATCTTCGAAGATCTTCGAAGATMutated HSEsenseBiotin-TCGACTTCAAGCTTGTACAAGCTTGTAGMutated HSEantisenseAGCTGAAGTTCGAACATGTTCGAACATC‘Scrambled’oligonucleotideBiotin-AACGACGGTCGCTCCGCCTGGCT 14 0406080 10 0 12 0Counts ... hAutoradiographyAdd D beads and incubateD A O2Read AlphaLISA signal at 615 nmHSEFig. 1. Comparison of EMSA and TransLISA for the detection of HSF1–DNA binding activity. (A) Schematic presentation...
  • 9
  • 457
  • 0
Tài liệu Báo cáo khoa học: Interferon-a induces sensitization of cells to inhibition of protein synthesis by tumour necrosis factor-related apoptosis-inducing ligand ppt

Tài liệu Báo cáo khoa học: Interferon-a induces sensitization of cells to inhibition of protein synthesis by tumour necrosis factor-related apoptosis-inducing ligand ppt

... 15 Shigeno M, Nako K, Ichikawa T, Suzuki K, Kawakami A, Abiru S, Miyazoe S, Nakagawa Y, Ishikawa H,Hamasaki K et al. (2003) Interferon -a sensitizes humanhepatoma cells to TRAIL-induced apoptosis ... c release, mitochondrial membranedepolarization, caspase-3 activation, and Bax -a cleavageduring IFN -a- induced apoptosis in Daudi B lymphomacells. J Interferon Cytokine Res 20 , 11 21 11 29.45 ... Pokrovskaja K,Sangfelt O, Castro J, Einhorn S & Grande´r D (2002)Mechanisms of interferon-alpha induced apoptosis inmalignant cells. Oncogene 21 , 12 51 12 62.46 Saelens X, Kalai M & Vandenabeele...
  • 11
  • 679
  • 0
Tài liệu Báo cáo khóa học: TbPDE1, a novel class I phosphodiesterase of Trypanosoma brucei pdf

Tài liệu Báo cáo khóa học: TbPDE1, a novel class I phosphodiesterase of Trypanosoma brucei pdf

... template. PDE1(Arg189–Thr620) was amplified using theprimer pairs 5¢-GGGAATTCCATATGAGAGACAATATTTCCCGTTTATCAAATC-3¢ and 5¢-CCGCTCGAGTCATTACTAGGTTCCCTGTCCAGTGTTACC-3¢ ,and PDE1(Lys3 21 Thr620) was amplified ... 5¢-GGGAATTCCATATGAAGAATGATCAATCTGGCTGCGGCGCAC-3¢ and 5¢-CCGCTCGAGTCATTACTAGGTTCCCTGTCCAGTGTTACC-3¢. The resulting DNAfragments (1. 29 and 0.90 kbp) were digested with NdeI and XhoI and cloned ... isolation and analysis of drug-resistantmutants of a mammalian phosphodiesterase. Proc. Natl Acad. Sci.USA 90, 11 970 11 974.34. Boeke, J.D., Trueheart, J., Natsoulis, G. & Fink, G.R. (19 87)5-Fluoroorotic...
  • 11
  • 566
  • 0
Tài liệu Báo cáo khóa học: Trichostatin A reduces hormone-induced transcription of the MMTV promoter and has pleiotropic effects on its chromatin structure pptx

Tài liệu Báo cáo khóa học: Trichostatin A reduces hormone-induced transcription of the MMTV promoter and has pleiotropic effects on its chromatin structure pptx

... were analyzed and quantified on a Fuji Bio-Imaging analyzer BAS-2500 usingIMAGE GAUGEV3.3 software.Chromatin and protein–DNA analysisMicrococcal nuclease (MNase) digestion and in situ cleavage by ... Biotechnology) and acetylated H3 (Upstate Bio-technology), and antibodies against specific modificationssuch as acetylated H3-K9 (Cell Signaling Technology) and H3-K14 (Abcam) and anti-H3 C-terminal (Abcam). ... revised 26 January 2004,accepted 30 January 2004)Eur. J. Biochem. 2 71, 11 53 11 62 (2004) Ó FEBS 2004 doi :10 .11 11/ j .14 32 -10 33.2004.04 019 .xgenes. The studies have revealed that both histone acetyl-transferases...
  • 10
  • 500
  • 0
Tài liệu Báo cáo khoa học: Yeast glycogenin (Glg2p) produced in Escherichia coli is simultaneously glucosylated at two vicinal tyrosine residues but results in a reduced bacterial glycogen accumulation docx

Tài liệu Báo cáo khoa học: Yeast glycogenin (Glg2p) produced in Escherichia coli is simultaneously glucosylated at two vicinal tyrosine residues but results in a reduced bacterial glycogen accumulation docx

... chromatogram, peaksin the original region (fractions 11 15 ; Fig. 3A) disappeared and new peaks (fraction 12 , 15 and 18 ; Fig. 3B) weredetected indicating that the amyloglucosidase treatment waseffective. ... a- amylasetreatment were separated by RP-HPLC (SMART system,Pharmacia, Uppsala, Sweden) on a Pharmacia C2/C18 SC2 .1/ 10 column using a linear 0–50% (v/v) acetonitrilegradient containing 0 .1% ... chemical clea-vage, the peptide mixture was incubated with a hydro lase(such as a- amylase) and was then separated by HPLC.Enzymatic deglucosylation was found to be essential asfragmentation...
  • 12
  • 513
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Creating a manually error-tagged and shallow-parsed learner corpus" pptx

... Computational Linguistics, pages 12 10 12 19,Portland, Oregon, June 19 -24, 2 011 .c2 011 Association for Computational LinguisticsCreating a manually error-tagged and shallow-parsed learner corpusRyo ... NorthAmerican Chapter of the ACL, pages 15 4 16 2.Joel Tetreault, Elena Filatova, and Martin Chodorow.2 01 0a. Rethinking grammatical error annotation and evaluation with the Amazon Mechanical Turk. ... head words. In Proc. of Cognition and ExploratoryLearning in Digital Age, pages 18 4 19 1.Ryo Nagata, Takahiro Wakana, Fumito Masui, AtsuoKawai, and Naoki Isu. 2005. Detecting article...
  • 10
  • 467
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "MemeTube: A Sentiment-based Audiovisual System for Analyzing and Displaying Microblog Messages" pdf

... ACL-HLT 2 011 System Demonstrations, pages 32–37,Portland, Oregon, USA, 21 June 2 011 .c2 011 Association for Computational LinguisticsMemeTube: A Sentiment-based Audiovisual System for Analyzing ... emoticons. This is similar to what many people have proposed for evaluation (Davidov et al. 2 010 ; Sun et al. 2 010 ; Bifet and Frank 2 010 ; Go et al. 2009; Pak and Paroubek 2 010 ; Chen et al. 2 010 ). ... February 7th 2 011 . The resulting video ex-presses negative valence and neutral arousal. After checking the posts, we have learned that it is be-cause the Japanese volcano Mount Asama has con-tinued...
  • 6
  • 449
  • 0

Xem thêm

Từ khóa: tài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdftài liệu báo cáo nghiên cứu khoa họctài liệu về báo cáo khoa họcbáo cáo khoa học công nghệ phục vụ nông nghiệp và phát triển nông thôn các tỉnh phía bắc 2006 2007 tài liệu phục vụ hội nghịbáo cáo khoa học tài chính côngbáo cáo khoa học số loài quý hiếm tại vườn quốc gia ba bểtai lieu bao cao thuc tap khoa co khitai lieu bao cao thuc tap tai khoa duoc benh vientai lieu bao cao thuc tap y si da khoabáo cáo khoa học ảnh hưởng của tuổi thu hoạch đến năng suất và chất lượng thức ăn của cỏ voi pennisetum purpureum cỏ ghi nê panicum maximum trồng tại đan phượng hà tây pptxtai lieu bao cao thuc tap tim hieu nhan cach mot hoc sinhbáo cáo khoa học về nghệ thuật trong lieu trai chi ditai lieu bao cao thuc tap tai khoa duoc benh vien hop lucđề tài báo cáo khoa họcđề tài báo cáo khoa học sinh họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXBT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ