flubendazole as a therapeutic agent against rotifers brachionus plicatilis in intensive cultures of the harpacticoid copepod tisbe holothuriae
Efficacy of meperidine versus tramadol as a treatment agent on post spinal anaesthesia shivering, hemodynamic stability and therapeutic side effects in parturients at mateme gandhi memorial hospital,
Ngày tải lên :
15/08/2017, 15:10
... criteria Time from treatment to cessation of PSAS in minutes, Hemodynamic variables before spinal anesthesia (baseline), after spinal anaesthesia, at 5,10 and 30 minutes after PSAS was treated ... and tramadol was compared for baseline, before treatment of PSAS and minutes, 10 minutes and 30 minutes after PSAS treated The baseline heart rate was comparable between meperidine and tramadol, ... Hospital, Addis Ababa, Ethiopia Name of Principal Investigator: Ashenafi Seifu Name of advisor: Mr Adugna Aregawi Name of the Organization: Addis Ababa University, College of medicine, Anesthesia program...
- 43
- 159
- 0
Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx
Ngày tải lên :
07/03/2014, 10:20
... because of an imbalance in the activity of tau kinases and phosphatases [3] One particular tau kinase pertinent to metal dyshomeostasis in AD is glycogen synthase kinase-3 (GSK3) GSK3 has recently ... decreased availability of intracellular Cu [83] and up-regulated by increased availability of Cu [84] Collectively, these data present a strong case for the native role of APP ⁄ Ab in regulating intracellular ... is ablated [41] Amyloid-b After the 4.5 kDa Ab peptide was identified as a major component of the amyloid plaques in AD brain [42,43], global AD research focused on this peptide as a causative agent...
- 9
- 634
- 0
Báo cáo khoa học: Quantitative assessment of the glyoxalase pathway in Leishmania infantum as a therapeutic target by modelling and computer simulation pot
Ngày tải lên :
23/03/2014, 13:20
... glyoxalase pathway in Leishmania infantum A Fig Sensitivity analysis of the glyoxalase pathway in Leishmania infantum The effects of system parameters on the intracellular steady-state concentration ... enzymes was then evaluated in this parasite by initial rate analysis Using the methylglyoxal glutathione hemithioacetal as substrate, the kinetic parameters for L infantum glyoxalase I, were a Km of ... http://jjj.biochem.sun ac.za/database/silva/index.html free of charge Results and Discussion The potential of the glyoxalase system as a possible therapeutic target relies on its role as the main catabolic pathway...
- 11
- 515
- 0
Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc
Ngày tải lên :
18/06/2014, 16:20
... Altogether, these findings indicate that Jak3 and STAT 5a/ b signals are required to maintain normal numbers of Treg cells in peripheral lymphoid organs and maintain self-tolerance downstream of IL-2/IL-2R ... T, Nakanishi K, Shimada A, Uga M, Kurihara S, Kawabata Y, et al: Genetic association between the interleukin-2 receptor-alpha gene and mode of onset of type diabetes in the Japanese population ... by an antigen vaccination strategy This has proven efficient in the NOD mouse model, as well as in other murine models of T1D [95-100] The feasibility of translating these therapies to humans...
- 12
- 573
- 0
Báo cáo hóa học: " Solvothermal synthesis of uniform bismuth nanospheres using poly(N-vinyl-2-pyrrolidone) as a reducing agent" pptx
Ngày tải lên :
21/06/2014, 06:20
... was transferred into a stainless steel autoclave with Teflon liner The autoclave was sealed and maintained at 180°C for 12 h After cooling to room temperature, the obtained black solution was ... China Authors’ contributions JW participated in the acquisition of data and drafted the manuscript FQ carried out the SEM characterization and participated the analysis and interpretation of data ... N-dimethylformamide (DMF), ammonia, mannitol, and EG were purchased from Sinopharm Chemical Reagent (China); PVP (with average Mw of 10,000) was purchased from Sigma-Aldrich Inc All the reagents were analytical...
- 8
- 457
- 0
Báo cáo y học: "B cells as a therapeutic target in autoimmune disease" doc
Ngày tải lên :
09/08/2014, 01:21
... by the US National Institutes of Health is in the planning stage 132 Although autoantibodies in autoimmune cytopenias and some other diseases, such as pemphigus and myasthenia gravis, have a direct ... Arthritis Research & Therapy Vol No Goronzy and Weyand appears to activate proapoptotic pathways, further increasing the antibody’s depleting activity [7] Rituximab has been used in the treatment ... immunoglobulin levels are usually maintained, possibly as a consequence of plasma cells being spared B-cell depletion in antibody-mediated diseases It is understandable that rituximab has been most...
- 5
- 410
- 0
Báo cáo y học: "Evaluation of recombinant invasive, non-pathogenic Eschericia coli as a vaccine vector against the intracellular pathogen, Brucella" pptx
Ngày tải lên :
11/08/2014, 08:21
... αβ1integrin heterodimer Upon clustering of integrins, invasin activates signaling cascades One signaling pathway causes activation of components of focal adhesion complexes including Src, focal ... Falkow S, Schoolnik GK: The invasin protein of Yersinia enterocolitica: internalization of invasin-bearing bacteria by eukaryotic cells is associated with reorganization of the cytoskeleton J Cell ... was present in macrophage cell lines (RAW and J774) An example with TB1 and RAW264.7 cells is shown in Figure To further determine whether the invasive E coli were intracellular, invasion assays...
- 14
- 386
- 0
Báo cáo y học: "Th2 cytokines and asthma Interleukin-9 as a therapeutic target for asthma" ppsx
Ngày tải lên :
12/08/2014, 18:20
... mice, including significant increases in BAL eosinophils, elevated serum total IgE, increased mucin production, and AHR in comparison with control or naive animals Intratracheal administration of ... granulocytes [47] Mast cells are also important effector cells in asthma, and increased numbers of intra-epithelial lung mast cells were a noteworthy, apparently unique, finding in both strains ... independently of IL-4 in experimental asthma Science 1998, 282:2261–2263 Temann UA, Geba GP, Rankin JA, Flavell RA: Expression of interleukin in the lungs of transgenic mice causes airway inflammation, mast...
- 5
- 246
- 0
targeting cancer cell metabolism as a therapeutic strategy
Ngày tải lên :
22/12/2014, 20:36
... lyase ACN, aconitase ADP, adenosine diphosphate ALD, aldolase ALT, alanine transaminase AKT, protein kinase B AML, acute myeloid leukemia AMP, adenosine monophosphate AMPK, AMP activated protein ... humans due to the presence of asparagine synthetase (ASSN), certain tumour types like leukaemia have little ASSN activity and require exogenous asparagine This has led to the use of asparaginase, ... essential amino acid, some hepatocellular carcinoma (HCC), mesothelioma and melanomas not express argininosuccinate synthetase (ASS), and therefore are auxotrophic for arginine and hence are sensitive...
- 121
- 191
- 0
Polo like kinase 1 in hepatocellular carcinoma clinical significance and its potential as a therapeutic target
Ngày tải lên :
16/10/2015, 15:38
... nuclear fragmentation in apoptotic cells as early as 24 hours after transfection Caspase-3 activity assay was carried out (Fig 8) and intrigued to find that caspase-3 activation in si-PLK1 transfected ... buffer was added and supernatant was subsequently transferred to a microplate that was coated with anti-caspase-3 for hour at 37oC Substrate solution was then added for hours at 37oC after a washing ... to involve in negatively regulating PLKs kinase activity as C-terminal deletion in wild-type and T210D PLK mutant gain noticeable increase in kinase activity (Jang et al., 200 2a; Mundt et al.,...
- 84
- 215
- 0
DSpace at VNU: Maleated Natural Rubber as a Coupling Agent for Recycled High Density Polyethylene Natural Rubber Kenaf Powder Biocomposites
Ngày tải lên :
16/12/2017, 10:27
... increased with increasing filler loading The water absorption was found to increase as the filler content increased The maleic anhydride grafted natural rubber was prepared and used to enhance the composites ... Malaysia E-mail: hanafi@eng.usm.my Kenaf is gaining a lot of attention in the composite industry, since they can be applied as filler in polymer composites It is widely planted in Malaysia and was ... composites made of recycled materials Waste Manage 2009, 29, 1291–1295 10 Ismail, H.; Abdullah, A. H.; Bakar, A. A The effects of a silane-based coupling agent on the properties of kenaf core-reinforced...
- 8
- 169
- 0
Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt
Ngày tải lên :
06/03/2014, 22:21
... AGCTGGTGCAGGAGGAAGTA CCGAGAACCGAACTTACCAA AGGAAGCACCCAGCAATACCA CACCTTGGATGGGTATTCCA CACAGCTCCCATTCATTCCA TCCTCCCTGGAGAAGAGCTA CTCCTGGGACACGATGC CTGCGGTGCTGTTGTGG CACCATCATAAGGGTAAACAT ACAGCAAAAAGGAGGCCAAA ... identified in a number of solid tumors, including renal carcinomas and, particularly, clear cell adenocarcinomas, cervical squamous carcinomas, ovarian carcinomas, colorectal carcinomas, esophageal carcinomas, ... BCRP CA9 BMP2 MT 2A CD237904 AL707095 AK095731 DKK1 BC037851 b-Actin GAAGAAGGGCCAGACGC CCTTCGCTGAGTTCCTGC ACATCAGCGGATACTACAGAG TTTGAATGGGCGAGTGATTG CGGAAACGCCTTAAGTCCAG AATAAGCTTCCGACTCTAGCCGC AGCTGGTGCAGGAGGAAGTA...
- 13
- 563
- 0
Báo cáo y học: "A monoclonal antibody against kininogen reduces inflammation in the HLA-B27 transgenic rat" pptx
Ngày tải lên :
09/08/2014, 06:22
... leukocytosis and the acute-phase reaction) in the PG-APS model [42] The same plasma kallikrein inhibition modulated acute intestinal changes [28] as well as chronic granulomatous intestinal inflammation ... blocking KKS activation and decreasing the signs of inflammation [20] The HLA-B27 transgenic rat model has been used for several years to evaluate the activity and mechanisms of actions of anti-inflammatory ... HLA-B27-associated inflammatory disease Each of the previous approaches to inhibiting the KKS to control inflammation was successful but had certain limitations The plasma kallikrein active-site inhibitor...
- 8
- 452
- 0
báo cáo khoa học: " HIV as a chronic disease considerations for service planning in resource-poor settings" docx
Ngày tải lên :
11/08/2014, 14:21
... in each of these cases the main reason stated by patients was the cost of purchasing their medication Financial barriers may rise after a patient’s condition is stabilised: when a patient has ... undertaken in place of triple therapy as a cost-saving measure, resistance will develop much faster, as shown by an Indian study India has now commenced free first-line treatment for 340,000 Indian ... When symptomatic HIV cases start to emerge in numbers, the total cost of managing and treating a national caseload quickly becomes substantial, because treatment involves lifelong intake of recently...
- 6
- 291
- 0
Báo cáo y học: " Factor correction as a tool to eliminate between-session variation in replicate experiments: application to molecular biology and retrovirology" ppsx
Ngày tải lên :
13/08/2014, 09:21
... nature of the between-session variation in this data set is apparent from the fact that the lines connecting the data points in each session run approximately parallel in a logarithmic plot of ... Figure A: original data B: normalised data C: standardised data D: data after factor correction Note that normalisation, standardisation, and factor correction reduce the variation within each condition ... rection Comparison of normalisation, standardisation and factor corComparison of normalisation, standardisation and factor correction Mean (and SEM) of the data of the molecular-biology data set from...
- 8
- 304
- 0
Lesson Study as a Means to Innovation for Good Practices in Teaching and Learning Mathematics in Vietnam
Ngày tải lên :
13/08/2015, 10:21
... thirteen mathematics teachers observed in the classes After observing the actual classes, a meeting was organised in order to share ideas and provide feedback During the meeting, the teachers gave a ... student learning The use of this innovation for the teaching and learning of mathematics in the classroom must be implemented to engage students in meaningful mathematical tasks that require ... to teaching and learning of mathematics in the school The innovation as a product of the lesson study helps students have a better and more meaningful understanding of difficult mathematical concepts...
- 10
- 319
- 0
Learner autonomy as perceived by teachers and students at nguyen van linh high school a thesis submitted in partial fulfillment of the requirements for the degree of master of arts in TESOL
Ngày tải lên :
04/07/2017, 20:44
... 1.1 Rationale of the study In the past few decades, there has been a dramatic surge in the field of language teaching In traditional classes, where teachers try to tell their learners what to ... work, is really a considerable issue Then autonomy is worth noticing as a vital aspect in language teaching and learning for fostering life-long learning Another important value of learner autonomy ... skills, learning strategies and their preference in taking the initiative in learning as well as their active in learning inside and beyond the class In line with Le (2013), Humphreys & Wyatt (2013)...
- 112
- 351
- 1
DSpace at VNU: Possibility of using a lithotrophic iron-oxidizing microbial fuel cell as a biosensor for detecting iron and manganese in water samples
Ngày tải lên :
16/12/2017, 11:35
... replaced in the device and lasted until when the current dropped down to the baseline (ca 0.1 mA) The duration of such a batch was usually hours Each reactor was operated for at least batches per day ... between the poly-acrylic parts when the reactor was assembled A cm  cm Naon 117 membrane (Du Pont, USA) was used to separate the two compartments of each reactor Each reactor was assembled using ... for the current to reach a steady state in any test) was about 60 s when the concentration of Fe2+ was step increased When the concentration of Fe2+ was step decreased, the response was usually...
- 10
- 159
- 0
A research proposal submitted in partial fulfillment of the requirements for the degree of Master of Business Administration
Ngày tải lên :
13/04/2013, 10:30
... Philippines; Macro is in Thailand and Taiwan, Carrefour from France is in Taiwan; and Wellcome is in Taiwan, Hong Kong, Mainland China and Singapore Major Japanese department stores are in most Asian cities ... mushrooming all over the country’s main cities at an unprecedented growth rate And in Indonesia, the changing spending patterns within the Jakarta area are contributing to an increase in the use of department ... itself as the top quality supplier for the upper end of the market and tries to present an international image (Kawahara and Speece, 1994) Singapore is the easiest place in Asia for international...
- 51
- 1K
- 3
