• protected resources the stuff oauth protects and allow access to this can be data photos documents contacts activities posting blog item transferring funds or any url with a need for access restrictions
Comparing the cultural and linguistic analysis of the English word “meal” and words relating to it in contrast with Vietnamese equivalents.
... or adapt another language as their second language All the language (native and foreign languages), always convey cultural characteristics It is the basic cultural factor that distinguishes this ... people at home not have a full breakfast according to traditional breakfast as well as conditional breakfast They often have cereal or porridge, egg and bacon followed by toast and marmalade and ... is a small meal and easy to prepare: a bread roll or croissant with cheese or ham and a cup of coffee And the most common drinks at this time of day are orange juice or a cup of breakfast tea or...
- 54
- 1,037
- 1
Bacteria are often maligned as the causes of human and animal disease (like this one, Leptospira, which causes serious disease in livestock)
... vomiting, anorexia abdominal pain - headaches - arthralgia (neuralgic pain in joints) - myalgia (muscular pain or tenderness), back pain - mucosal redness of the oral cavity, dysphagia (difficulty ... Ebola Ebola Gene sequences in liver and spleen Fruit bats not show any symptoms Best candidate to be the reservoir More research needs to be done Geography The link between human infection by the ... tachypnea (rapid breathing) ** Patients who progressed to phase two EHF almost always die (Ndambi et al., 1999) Late Complications: -Arthralgia - ocular diseases (ocular pain, photophobia and...
- 15
- 782
- 0
The relationships of forest and watershed characteristics to soil water retention, storm, runoff, erosion, and wave attenuation in vietnam
... decreasing ranking, moderate forest, poor forest, regeneration forest, and grass + shrub This indicates that moderate forest and poor forest can prevent runoff or flood better than regeneration forest ... development, the demand land for agricultural and other sectors has increased, creating conflicts between land managers Natural forests, mostly distributed in mountainous areas have experienced high deforestation ... delineate and extract reference data for 15 watersheds in Vietnam; (2) to identify and calculate watershed and vegetation factors affecting storm runoff responses; (3) to analyze the relationship between...
- 18
- 534
- 0
báo cáo hóa học:" Research Article Pitch- and Formant-Based Order Adaptation of the Fractional Fourier Transform and Its Application to Speech Recognition" pptx
... Consequently, there are relatively fast changes of pitch which are usual and informative In Mandarin, there are four basic lexical tones and a neutral tone The number of tonal syllables is about 1,300, and ... signal with a chirp rate corresponding to the transform order p can be transformed into an impulse in a certain fractional domain For instance, it can be seen from the kernel function form in ... help to get more accurate formant estimates and also more discriminative speech features This is the motivation for the order adaptation method based on pitch and formants that is introduced in the...
- 14
- 384
- 0
Báo cáo hóa học: " Research Article The Generalized Gronwall Inequality and Its Application to Periodic Solutions of Integrodifferential Impulsive Periodic System on Banach Space" potx
... X As a result, P is a compact operator In order to use Leray-Schauder fixed pointed theorem to examine whether the operator P has a fixed point, we have to make assumptions H2.2 and H2.5 a little ... and Applications, vol 66 of Pitman Monographs and Surveys in Pure and Applied Mathematics, Longman Scientific & Technical, Harlow, UK, 1993 V Lakshmikantham, D D Bainov, and P S Simeonov, Theory ... show that P defined by 4.21 is a continuous and compact operator Lemma 4.6 Suppose that {T t , t ≥ 0} is a compact semigroup in X Then the operator P is a continuous and compact operator Proof...
- 22
- 296
- 0
research report 'using the activity in pairs and in groups to teach writing in english'
... preparation for writing The members of a pair, or larger group, can actually the writing together They can discuss the exact words and sentences to be used, and then either each student writes down what ... was said, or else they appoint one member of the group to be the writer for all of them It is always important for the teacher to move fairly around the room, helping each group with vocabulary, ... - Ask the students to get into pairs Give out copies of one text to half of the class and the other text to the half - Ask them to list all the words in their text alphabetically - Ask the students...
- 4
- 470
- 1
summary of agricultural doctoral thesis studying the growth, development capacities and technical measures to increase yields, qualities of some exotic orchid cultivars (cattleya, dendrobium, oncidium) for nort
... Florida to the Bahamas, Caribbean Islands and southern Mexico, Central and South America to Argentina [122] By studying botanical characteristics and for external requirements for Cattleyas, Dendrobium, ... other orchids and these have brought about big financial resources for orchids producing branches in countries as Netherlands, China, Taiwan, Thailand The above results show that the world has ... general and for orchids in particular and have achieved very satisfactory results, especially on some industrial orchids as Dancing lady (Oncidium), Hoang Thao (Dendrobium), Cat (Cattleya) and some...
- 27
- 553
- 0
báo cáo khoa học: " Assessing the spatial distribution of methadone clinic clients and their access to treatment" ppsx
... Overall, about half (55.6%) went to the clinic by walking and 30.2% by cycling, so they did not need to pay for their daily trip A minority (14.3%) had to pay for the transportation Using one-way ANOVA, ... interviewing methadone clients The authors thank all respondents for their participation in the study, social workers and outreach workers of the methadone clinic for their support and advice Received: ... methadone clinics about 30 years ago It can be argued that in order to have good access to methadone, some heroin users might have migrated from their original areas of gathering to the new neighbourhoods...
- 6
- 237
- 0
báo cáo khoa học: " TRIPS, the Doha Declaration and increasing access to medicines: policy options for Ghana" pdf
... regarding the private sector management chain and public sector supply management chain need examination and adjustment to make medicines more affordable for patients Ghana has potential to supply ... such a regional trade area must have been formed in conformity with the provisions of Article XXIV of GATT[15] To date, only Canada, Norway and the Netherlands have passed legislation to allow ... necessary policy reform is needed in the area of national tax, tariff and mark-ups to determine what changes could facilitate more affordable prices for the population Is the Ghana case generalisable...
- 10
- 307
- 0
Báo cáo y học: "Could the expression of CD86 and FcγRIIB on B cells be functionally related and involved in driving rheumatoid arthritis" pps
... and the modulation of B cell activity and humoral tolerance has also been translated into humans Expression of FcγRIIB was found to be considerably decreased in memory B cells from patients with ... and B cell activation, especially in the context of inflammatory disease, requires further exploration The results presented by Catalán and colleagues go some way to support the hypothesis that ... Page of Finally, if FcγRIIB truly acts as a late checkpoint at the level of class-switched B cells or antibody-producing plasmablasts/plasma cells, and considering that autoreactive B cells are...
- 2
- 227
- 0
Báo cáo y học: "Analysis of the contribution of cellular and viral RNA to the packaging of APOBEC3G into HIV-1 virions" docx
... ctgtccattcattgtatggc aaagactagtcaagtgcagtagtgag aaaggctagtcaagtgaagcagtgg aaagccagtcaaatttagcagtggg aaaacatgcaagctagtcaagcgcg ggggaaagcgcgaacgcagtccccc ggtgcactgttcctggaggtactgc cagtctccgtagagactgtcaaaaattg ... cctggcaggggagataccatgatcacg cttcttggccttttagctaagatc gctttgcgcagtggcagtatcg gtgctcgcttcggcagcacatatac catttcaccatctggttggctggctc gaagatggtgatgggatttc ctagaagcatttgcggtggacg cccgggaggtcaccatatt ... of any of the tested cellular RNAs Figure and APO3G packaging Correlation between cellular and viral RNA encapsidation Correlation between cellular and viral RNA encapsidation and APO3G packaging...
- 11
- 238
- 0
the jobs crisis; household and government responses to the great recession in eastern europe and central asia (wb, 2011)
... program performance can be improved (Armenia, Poland), guidelines can be altered to increase coverage (Latvia, Romania), benefit amounts can be increased (Azerbaijan, Georgia, Kazakhstan, Latvia, ... Estonia, Russia, Turkey); and expanding access to training or retraining (Bulgaria, Russia) Social assistance Some Eastern European and Central Asian countries leveraged Last-Resort Social Assistance ... implementing ad hoc emergency measures UI benefits worked well as an automatic stabilizer in nine Eastern European and Central Asian countries for which benefits monitoring data are available In Bulgaria,...
- 136
- 362
- 0
Insights into the mechanism of safingol and its potential to synergize with anti cancer drugs
... There are two groups of caspases The initiator caspases include caspase 8, 9, 10 and the effector caspases include caspase 3, 6, The initiator caspases function to cleave and activate effector ... membrane (phagophore) Atg activates Atg 12 and Atg 12 is transferred to Atg 10 before conjugates with Atg Then, Atg 16 conjugates to Atg12-Atg5 and attaches Atg12-Atg5-Atg16 complex to phagophore ... interacts with pro-caspase and 10 to form the death-inducing signaling complex (DISC) Pro-caspase and 10 are self-cleaved Activated caspase and 10 in turn activate the effector caspases 3, 6, and...
- 166
- 459
- 0
The relationship of psychological and personality factors to post concussive symptoms (PCS) in mild traumatic brain injury (MTBI) patients
... Trauma and are not better accounted for by another mental disorder (e.g Amnestic Disorder Due to Head Trauma, Personality Change Due to Head Trauma) From the “Diagnostic and Statistical Manual ... were informed in advance through a text message and/ or a phone call that they should expect a phone call on a particular date and time and were requested to have a pen and paper ready for answering ... Fluency (Animals) Test of Memory Malingering (TOMM) 5.5 Data Analysis Data analysis was performed using SPSS version 16.0 The alpha level for all statistical analyses was set at 05 unless otherwise...
- 131
- 432
- 0
3341 at the bank vocabulary comprehension and grammar american money bank can 6 tasks 2 pages editable
... dressed? ( Can Marian stay out until 12 tonight? ( Can you close the window? ( ) ) ) ) Can your kids go with me to the park this afternoon, Amanda? ( Can you walk the dog for me, please? ( Can I help ... tonight? ( ) Can you bring me those books over there? ( ) Can Sally go out and play with me, Mrs Smith? ( Can we something for you? ( Can I give you a lift home? ( ) ) Can you wait for me outside ... offers or requests: Can we go outside? (permission) Can I help you? (offer) Can you close the door (request) Mark (P) for permission, (O) for offer and (R) for request: Can I wear your blouse tonight?...
- 2
- 388
- 1
báo cáo hóa học: " Funding free and universal access to Journal of Neuroinflammation" doc
... acceptance, so an author's work can be read by anyone at no cost Second, the article authors retain copyright for their work, and grant to anyone the right to reproduce and disseminate the article, ... waivers are available for cases of genuine financial hardship These will be considered on a case-by-case basis by the Editors-in-Chief What article-processing charges pay for? The APC pays for ... cash-strapped libraries cancelling journal subscriptions [2], thus limiting the range of articles available to many readers and limiting the potential audience available to authors The Open Access...
- 3
- 286
- 0
báo cáo hóa học:" From HIV diagnosis to treatment: evaluation of a referral system to promote and monitor access to antiretroviral therapy in rural Tanzania" doc
... diagnosis to treatment: Implementing a referral system to monitor access to ART in Kisesa Ward Dar es Salaam 2008 [http:// www.tazamaproject.org/TAZAMA_NACP_files.shtml] Zachariah R, Harries AD, ... services to begin at the [health] centres in each area It's easy to go, and perhaps we can succeed on this problem, to be known early and treated early before the infection advances [Roadside, male, ... socio-demographic information, and was retained by the referring party The unique VCT identifier allocated by the counsellors for each patient was recorded on this slip to enable referral data to be subsequently...
- 9
- 586
- 0
báo cáo hóa học:" Imprisoned and imperiled: access to HIV and TB prevention and treatment, and denial of human rights, in Zambian prisons" ppt
... interviews with government and NGO key informants We also reviewed Zambian laws and policies and international human rights laws and standards related to prison, HIV and TB Methods Zambia has a total ... PRISCCA, or the AIDS and Rights Alliance for Southern Africa (ARASA) - or in Bemba, Nyanja or Tonga, with translation into English provided by members of PRISCCA Interviewers used a brief verbal questionnaire ... Chari-Imbayago, Kelvin Musonda, Shadreck Lubita, Rodgers Siyingwa and George Chikoti for support in data collection and analysis This research was funded by Human Rights Watch and the AIDS and...
- 11
- 464
- 0
Báo cáo y học: "ArrayPlex: distributed, interactive and programmatic access to genome sequence, annotation, ontology, and analytical toolsets" docx
... Institute for human and mouse, Stanford Genome Database for yeast The transformation of this information to a single format and storage in a relational schema enabled a single set of ArrayPlex database ... downloaded forms to a structured query language (SQL) format that is loaded into the ArrayPlex relational database schema The transformation removes all of the organism-specific nature of the data ... important step in most DNA microarray analysis is that of data quality evaluation For example, it is important to check for any signal intensity bias and understand the effect of data normalization...
- 17
- 128
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến dòng điện stato i1 fi p2 phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25