0

—match an element a specific number of times

Báo cáo toán học:

Báo cáo toán học: "An Asymptotic Expansion for the Number of Permutations with a Certain Number of Inversions" docx

Báo cáo khoa học

... a substantially improved paper the electronic journal of combinatorics (2000), #R50 11 References [1] M Abramowitz and I .A Stegun, Eds., Handbook of Mathematical Functions with Formulas, Graphs ... upon parameterizing C (z = e it ; t ∈ [0, 2π]) and using the symmetry of the integrand For an integer n ≥ and real numbers a, b and x, let b n I(n, x, a, b) := a =2 sin t xtn3/2 cos sin t dt and ... Formulas, Graphs and Mathematical Tables, Dover Publications, New York, 1966 [2] E .A Bender, Central and Local Limit Theorems Applied to Asymptotic Enumeration, J Combinatorial Theory A 15 (1973),...
  • 11
  • 348
  • 0
Báo cáo y học:

Báo cáo y học: "Identification of a SmD3 epitope with a single symmetrical dimethylation of an arginine residue as a specific target of a subpopulation of anti-Sm antibodies" ppsx

Báo cáo khoa học

... epitopes assay Assay performance characteristics of the anti-SmD3 peptide (SMP) assay (a) Intra-assay and interassay variability, (b) linearity, and (c) receiver operating characteristic analysis ... Hoffman RW: The appearance of U1 RNP antibody specificities in sequential autoimmune human antisera follows a characteristic order that implicates the U1-70 kd and B'/B proteins as predominant ... 40:413-418 29 James K, Carpenter AB, Cook L, Marchand R, Nakamura RM: Development of the antinuclear and anticytoplasmic antibody consensus panel by the Association of Medical Laboratory Immunologists...
  • 11
  • 593
  • 0
Báo cáo sinh học:

Báo cáo sinh học: "An approximate theory of selection assuming a finite number of quantitative trait loci" docx

Báo cáo khoa học

... that N and L are rather e e large, the approximation is still correct for values of L as small as A similar analysis can be carried out for the model assuming a constant environmental variance, ... any value is written in the following way: ) f and g( value of a gamete and y a residual assumed to be random, so that the variance covariance matrix of Matings gene effects in new zygotes takes ... mean values and standard deviations over replicated runs of the following criteria: mean breeding value; genetic and genic variances, effective numbers of loci (equations [17] and [18] below) and...
  • 22
  • 186
  • 0
Báo cáo sinh học:

Báo cáo sinh học: "An FPT haplotyping algorithm on pedigrees with a small number of sites" ppsx

Báo cáo khoa học

... F: Algorithm Engineering for Optimal Graph Bipartization Journal of Graph Algorithms and Applications 2010, 13(2):77-98 doi:10.1186/1748-7188-6-8 Cite this article as: Doan and Evans: An FPT haplotyping ... sites to an arbitrary small number of sites Preliminaries A member is an individual A set of members is called a family if it includes only two parents and their children; it is a parent-offspring ... This graph transformation preserves the parities of lengths of all cycles and does not affect the parity constraint sets Spc Therefore the transformed graph has an edge bipartization set of size...
  • 8
  • 241
  • 0
Estimating Inflation Expectations with a Limited Number of Inflation-Indexed Bonds ∗ doc

Estimating Inflation Expectations with a Limited Number of Inflation-Indexed Bonds ∗ doc

Ngân hàng - Tín dụng

... ) and H2(xt )) are used to calculate a set of forecast observation points This set of points is used to estimate a mean and variance of the data forecasts • The mean and variance of the data ... References Australian Financial Markets Association 2008 Australian Financial Markets Report Beechey, M 2008 “Lowering the Anchor: How the Bank of England’s Inflation-Targeting Policies Have Shaped Inflation ... The parameters ατ and β τ (and Ωs−t ) are defined in appendix 2, ¯ ∗ and are similar to ατ and β ∗ from equation (5) τ 3.1 Data and Model Implementation Data Four types of data are used: nominal...
  • 32
  • 347
  • 0
Báo cáo khoa học: Esculentin-1b(1–18) – a membrane-active antimicrobial peptide that synergizes with antibiotics and modifies the expression level of a limited number of proteins in Escherichia coli doc

Báo cáo khoa học: Esculentin-1b(1–18) – a membrane-active antimicrobial peptide that synergizes with antibiotics and modifies the expression level of a limited number of proteins in Escherichia coli doc

Báo cáo khoa học

... ML, Maisetta G, Di Luca M, Gaddi LM, Esin S, Florio W, Brancatisano FL, Barra D, Campa M & Batoni G (2008) Comparative analysis of the bactericidal activities of amphibian peptide analogues against ... where A and B are the MICs of drug A and drug B in the combination, MICA and MICB are the MICs of drug A and drug B alone, FICA and FICB are the FICs of drug A and drug B and n is the number of ... design of potential coadjuvants of those antimicrobial agents that are already available after incubation for 18–20 h at 37 °C Antibacterial activity was expressed as MIC, the concentration of peptide...
  • 18
  • 494
  • 0
RESEARCH DISCUSSION PAPER: Estimating Infl ation Expectations with a Limited Number of Infl ation-indexed Bonds doc

RESEARCH DISCUSSION PAPER: Estimating Infl ation Expectations with a Limited Number of Infl ation-indexed Bonds doc

Ngân hàng - Tín dụng

... ) and H2(xt )) are used to calculate a set of forecast observation points This set of points is used to estimate a mean and variance of the data forecasts • The mean and variance of the data ... this paper are those of the authors and are not necessarily those of the Reserve Bank of Australia Author: finlayr at domain rba.gov.au Media Of ce: rbainfo@rba.gov.au Abstract We estimate inflation ... parameters ατ and β τ (and Ωs−t ) are defined in Appendix B, and are similar ∗ to ατ and β ∗ from Equation (5) τ Data and Model Implementation 3.1 Data Four types of data are used in this analysis:...
  • 39
  • 395
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "GENERATING A SPECIFIC CLASS OF METAPHORS" pptx

Báo cáo khoa học

... view of focus of attention a word is treated as having a static semantics However metaphor can make the semantic type of objects more flexible By using a verb that only applies to humans, as above, ... eds., Aspects of Automated Natural Language Generation: The 6th International Workshop on Natural Language Generation Proceedings, Trento, Italy 231-246 George Lakoff (1987) Women, Fire and Dangerous ... Bodily Basis of Reason and Imagination University of Chicago press, Chicago, IL Mark A Jones and Kathleen F McCoy (1992) Transparently-Motivated Metaphor Generation In R Dale, E Hovy, D Rosner and...
  • 3
  • 267
  • 0
Báo cáo y học: Identification of an element within the promoter of human selenoprotein P responsive to transforming growth factor-b ppt

Báo cáo y học: Identification of an element within the promoter of human selenoprotein P responsive to transforming growth factor-b ppt

Báo cáo khoa học

... manufacturer’s instruction Mutagenesis was achieved using the 45-nucleotide primer 50 -GATAGGTACACAAAACCTTTTACATACTG AGTTGTAGAAAGAAGG-30 (exchanged nucleotides are in bold) and its complementary ... 30 and 60 min, respectively Lane depicts the protein preparation from lane containing 500-fold molar excess of unlabelled probe Lane 5, and each contain 500 ng of anti-Smad 2, and 4-specific antibodies, ... Sano, Y., Harada, J., Tashiro, S., Gotoh Mandeville, R., Maekawa, T & Ishii, S (1999) ATF-2 is a common nuclear target of Smad and TAK1 pathways in transforming growth factor-beta signaling J Biol...
  • 6
  • 361
  • 1
Báo cáo hóa học:

Báo cáo hóa học: " Application of Evolution Strategies to the Design of Tracking Filters with a Large Number of Specifications" potx

Báo cáo khoa học

... respect to the radar (radial and tangential projection of velocity heading), magnitude of the transversal acceleration, and magnitude of the groundspeed change There are four quality parameters in ... Complex and Adaptive Laboratory, involved in artificial intelligence applications His main interests are radar data processing, navigation, and air traffic management, with special stress on data fusion ... conditions are classified with respect to radar and aircraft characteristics because of the very different behavior of any tracker for varying input conditions Radar parameters represent the accuracy and...
  • 14
  • 342
  • 0
Báo cáo y học:

Báo cáo y học: "Lack of association of a variable number of aspartic acid residues in the asporin gene with osteoarthritis susceptibility: case-control studies in Spanish Caucasians" potx

Báo cáo khoa học

... the samples and participated in the design and analysis of the study, MP-S, ML and JJG-R evaluated the patients, and AG coordinated the study and participated in its design and analysis Acknowledgements ... Kizawa H, Kou I, Iida A, Sudo A, Miyamoto Y, Fukuda A, Mabuchi A, Kotani A, Kawakami A, Yamamoto S, et al.: An aspartic acid repeat polymorphism in asporin inhibits chondrogenesis and increases ... Research of Galicia and all cases and controls gave their written informed consent to participate All participants were of Spanish ancestry and resided in the reference area of the hospital Genotyping...
  • 4
  • 431
  • 0
Báo cáo khoa học:

Báo cáo khoa học: " A specific inhibitor of protein kinase CK2 delays gamma-H2Ax foci removal and reduces clonogenic survival of irradiated mammalian cells" pot

Báo cáo khoa học

... displayed mean values (and standard deviations) from at least independent determinations localized and transient changes of chromatin organization that would otherwise inhibit repair [34-36] Notably, ... DMSO before irradiation on ice and sample preparation Alternatively, cells were incubated for repair prior to lysis Data analysis involved quantification of the fraction of total DNA mass in electrophoretically ... MDC1 regulates intra-S-phase checkpoint by targeting NBS1 to DNA double-strand breaks Proc Natl Acad Sci USA 2008, 105:11200-11205 19 Ayoub N, Jeyasekharan AD, Bernal JA, Venkitaraman AR: HP1-β...
  • 13
  • 289
  • 0
Báo cáo y học:

Báo cáo y học: "The boy who refused an IV: a case report of subcutaneous clodronate for bone pain in a child with Ewing Sarcoma" pot

Báo cáo khoa học

... subcutaneously as needed every hour Adjuvant analgesics included round-the-clock gabapentin and naproxen He received lorazepam as needed and ondansetron and nabilone for nausea PEG 3350 and docusate ... [http://lists.act.org.uk/mailman/list info/paedpalcare] Duncan AR: The use of subcutaneous pamidronate J Pain Symptom Manage 2003, 26(1):592-593 Roemer-Bécuwe C, Vigano A, Romano F, Neumann C, Hanson ... use and by what route Cancer-related bone pain is a particularly difficult symptom to treat Bisphosphonates have gained acceptance as a standard approach to bone pain in adults In the idealized...
  • 4
  • 423
  • 1
Báo cáo y học:

Báo cáo y học: "Identification of 491 proteins in the tear fluid proteome reveals a large number of proteases and protease inhibitors" pot

Báo cáo khoa học

... Biosystems) Data Our data are freely available at the proteome database of the department of proteomics and signal transduction of the Max-Planck-Institut for Biochemistry [45] Additional data files ... Fleiszig SM, McNamara NA, Evans DJ: The tear film and defense against infection Adv Exp Med Biol 2002, 506:523-530 Kijlstra A, Kuizenga A: Analysis and function of the human tear proteins Adv Exp Med ... following additional data are available with the online version of this paper Additional data file lists all peptides and protein hits obtained in both LTQ-FT and LTQ-Orbitrap data Click here data Orbitrap...
  • 11
  • 289
  • 0
Fabrication of gold nanoparticle DNA conjugates bearing specific number of DNA for quantitative detection and well defined nanoassembly

Fabrication of gold nanoparticle DNA conjugates bearing specific number of DNA for quantitative detection and well defined nanoassembly

Tổng hợp

... strand B Lane P1 and Q1 correspond to the conjugates bearing strands of digested Strand A and Stand B respectively; Lane P2 and Q2 correspond to conjugates bearing strands of intact Strand A and ... 6.8 Hybridization efficiency of pure DNA (strand A and strand revA with different ratios of target DNA) Lanes 9-13 and correspond to strand A & strand revA with target DNA at a ratio of 1:1:0.2, ... bands change and additional retarded bands appear (4, 5) Because of the discrete character, each band can be directly assigned to a unique number of DNA strands per particle154 2.5.2 Conformation...
  • 174
  • 396
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " A retrospective evaluation of the impact of a dedicated obstetric and neonatal transport service on transport times within an urban setting" pptx

Hóa học - Dầu khí

... compare categorical data A mixed models analysis was employed using SAS Systems A repeated-measures ANOVA was used, where the year was regarded as the repeated measure and the factor was the variable ... in Data analysis Response times, transit times and mission times for all maternal and neonatal transfers were examined to establish performance in the two study periods A further comparison was ... this article as: De Vries et al.: A retrospective evaluation of the impact of a dedicated obstetric and neonatal transport service on transport times within an urban setting International Journal...
  • 6
  • 432
  • 0
Báo cáo y học:

Báo cáo y học: "Identification of an endogenous retroviral envelope gene with fusogenic activity and placenta-specific expression in the rabbit: a new "syncytin" in a third order of mammals" ppt

Báo cáo khoa học

... representation of a rabbit placenta (right) and haematoxylin and eosin staining of a day 12 placenta section (left) with the main layers of the placenta indicated (B) Higher magnification of the areas framed ... using an ABI PRISM 7000 sequence detection system Primer sequences were as follows: 5'-GCTGTTTTTATGCTAACAAGTCC and 5'-GATAAAGGTCATCAGC CT ATTGA for Env-Ory1 and 5'-CCTCTAAATGTCATCTTCACCAG and 5'-CTATTGGGACAGCAGTTCTAGTC ... quantitative RT-PCR analysis of Env-Ory1 and EnvReal-time quantitative RT-PCR analysis of Env-Ory1 and Env-Ory2 transcripts in rabbit tissues Transcript levels were normalized relative to the amount...
  • 11
  • 354
  • 0
Báo cáo sinh học:

Báo cáo sinh học: "A comparison between Poisson and zero-inflated Poisson regression models with an application to number of black spots in Corriedale sheep" doc

Báo cáo khoa học

... of the number of mastitis cases in dairy cattle 382 H Naya et al From previous exploratory analysis [16,24], the age of animals appears to be a main source of variability of the number of spots, ... overdispersion arises from an excess of zeros Zero-inflated models for count data in animal breeding have been discussed by Gianola [15] and used by Rodrigues-Motta and collaborators [27] in an analysis of ... ‘‘true’’ values of rams were known, their Spearman rank correlation with 388 H Naya et al Figure Histograms of Spearman rank correlations between true and posterior means of ram breeding values H4...
  • 16
  • 506
  • 0
Báo cáo y học:

Báo cáo y học: " A Novel Variable Number of Tandem Repeat of the Natriuretic Peptide Precursor B gene’s 5’-Flanking Region is Associated with Essential Hypertension among Japanese Females"

Y học thưởng thức

... like to thank Dr Y Watanabe and Dr Y Izumi for collecting the samples, and Ms H Tobe, M Nakamura, and K Sugama for their technical assistance This work was supported financially by a grant from ... (sense, 5’-AAGGAGGCACTGGGAGAGGGGAAAT-3’ (bases -1323 to -1299) and antisense, 5’CCCCACCAAGCCAACACAGGATGGA -3’ (bases -919 to-895) were used to amplify a 429-bp product from genomic DNA (Fig 1A) The ... Japanese Circ Res 2000; 86: 841-5 13 Nakayama T, Soma M, Rahmutula D, Ozawa Y, Kanmatsuse K Isolation of the 5'-flanking region of genes by thermal asymmetric interlaced polymerase chain reaction...
  • 7
  • 612
  • 1

Xem thêm