— astm c 42 c 42m precision statements
guide for obtaining cores and interpreting compressive strength results
Ngày tải lên :
24/10/2014, 17:40
... or Benjamin and Cornell (1970) 6.1 ASTM C 42 /C 42M precision statements ASTM C 42 /C 42M provides precision statements that quantify the inherent error associated with testing cores from a homogeneous ... Chapter 5—Testing the cores, p 214.4R-6 Chapter 6—Analyzing strength test data, p 214.4R-6 6.1 ASTM C 42 /C 42M precision statements 6.2—Review of core strength correction factors 6.3—Statistical analysis ... placed, according to ASTM C 42 /C 42M) can be stronger than cores drilled normal to this direction because bleed water can collect underneath coarse aggregate, as described in Chapter In practice,...
- 16
- 296
- 0
Báo cáo hóa học: " Confined conversion of CuS nanowires to CuO nanotubes by annealing-induced diffusion in nanochannels" ppt
Ngày tải lên :
21/06/2014, 05:20
... http://www.nanoscalereslett.com/content/6/1/150 AAO template It is expected that such CuO nanotubes may offer exciting opportunities for applications in catalysis, electrochemistry, superconductivity, ... SAED: selected area electron diffraction; SEM: scanning electron microscopy; TEM: transmission electron microscopy; XRD: X-ray diffraction Acknowledgements This study was supported by NSFC (Grant ... Podhajecky P, Zabransky Z, Novak P, Dobiasova Z, Eerny R, Valvoda V: “Relation between Crystallographic Microstructure and Electrochemical Properties of CuO for Lithium Cells” ElectrochimActa 1990,...
- 6
- 285
- 0
An investigation into some types of verbal responses to questions in English and Vietnamese conversation
Ngày tải lên :
07/11/2012, 14:54
... gives indirect response by implicating that the answer is Of course not! Q: C u c cho thi vào đ c đại h c không? A: Thế c u thấy chó c váy lĩnh cha? Q: Tay C n dạo nào? A: C n C n ... of casual, social talk that routinely occurs between friends and acquaintances, either face-to-face or on the phone According to Markee (2000) conversation analysis concerned with naturally occurring ... direct speech act When the syntactic form of an utterance does not match its apparent illocutionary force, we have an indirect speech act For example: Its raining How nice you are! 13 A declarative...
- 42
- 1.1K
- 4
Harvesting, oil extraction, and conversion of local filamentous algae growing in wastewater into biodiesel
Ngày tải lên :
05/09/2013, 15:28
... This reaction targets triacylglycerols; specifically the three fatty acid chains attached to a glycerol backbone Upon introduction of the base catalyst, fatty acids are removed, producing FAMEs ... Scientific Inc., Waltham, Massachusetts, USA) at 60 oC for 90 to conduct the transesterification reaction Following the reaction, samples were centrifuged (Model CL2, Thermo Fisher Scientific ... Sherma A Detection (visualization) of TLC zones in Encyclopedia of Chromatography (Ed Cazes J.), pp 248-251, CRC Press, 2009 [3] Fisher B .C. , Marchese A.J., Volckens J., Lee T., Collett J.L Measurement...
- 6
- 488
- 0
A study of semantic and syntactic features of idioms relating to fruits in english and vietnamese
Ngày tải lên :
26/11/2013, 13:21
... gang, mũi c chua, r n l i qu quýt, t c trái ñào, m t affected Vietnamese people’s thought For instance, tr ng dưa ñư c c nh i môi chu i m n, chu i tiêu lư i n c n c dưa or tr ng c ñư c cà In addition, ... speech and by Vietnamese people who like using verb underlying cultural characteristics such as geographical conditions, phrases very much” [72, p.324] This characteristic can be seen historical ... Language cannot exist without culture as its component Yellow as gold According to Tr n Ng c Thêm “Văn hóa bao g m t t c nh ng With more things in it làm cho dân t c kh c v i dân t c kh c (Culture...
- 13
- 1.3K
- 8
Alternate strategies for conversion of waste plastic to fuels
Ngày tải lên :
27/11/2013, 21:35
... formation of an olefinic carbonium ion: R+ + R2 CH = CH–CH2 CH2 CH2 CH2 CH3 ←→ R1 H + R2 CH = CH–CH2 CH2 CH2 + CHCH3 (8) The carbonium ion could undergo intramolecular attack on the double bond ... the polymer chains For instance, an olefinic linkage could be converted into an on-chain carbonium ion by proton addition: –CH2 CH2 CH = CHCH2 CH2 − + HX → CH2 CH2 + CHCH2 –CH2 CH2 + X− (4) ... low-molecular-weight carbonium ions (R+ ): –CH2 CH2 CH2 CH2 CH2 – + R+ → –CHCH2 + CHCH2 CH2 − + RH (6) Commercial name H-Ultrastabilised, Y-zeolite H-ZSM-5 zeolite H-Mordenite Synclyst 25 (silica-alumina) — Amorphous...
- 8
- 537
- 0
Tài liệu Báo cáo khoa học: "Robust Conversion of CCG Derivations to Phrase Structure Trees" pdf
Ngày tải lên :
19/02/2014, 19:20
... hereafter C& C-CONV, assign a schema to each leaf (lexical category) and rule (pair of combining categories) in the CCG derivation The PTB tree is constructed from the CCG bottomup, creating leaves ... sentences on which the C& C parser uses categories that lead to one extra correct node The main constructions on which parse errors occur, e.g PP attachment, are rarely converted incorrectly, ... PARSEVAL Precision, Recall, F-Score, and exact sentence match for converted gold CCG derivations unannotated categories, we use the instructions of the result category with an added instruction...
- 5
- 492
- 0
The Economic Effects of Restricted Access to Land in the West Bank ppt
Ngày tải lên :
17/03/2014, 06:20
... particular significance, as economic activity has been stifled by the ongoing conflict; and as much of the land area is inaccessible due to Israeli restrictions on movement of people and access ... inaccessible for economic intensification and investment Quantifying the economic impact of current restrictions is difficult given the paucity of data Consequently, this note analyzes the channels ... resources This policy note aims at analyzing the channels through which land access restrictions and market distortions constrain productive and public sector investment, and trace their effects...
- 48
- 529
- 0
The Economic Effects of Restricted Access to Land in the West Bank pdf
Ngày tải lên :
22/03/2014, 21:20
... particular significance, as economic activity has been stifled by the ongoing conflict; and as much of the land area is inaccessible due to Israeli restrictions on movement of people and access ... inaccessible for economic intensification and investment Quantifying the economic impact of current restrictions is difficult given the paucity of data Consequently, this note analyzes the channels ... resources This policy note aims at analyzing the channels through which land access restrictions and market distortions constrain productive and public sector investment, and trace their effects...
- 48
- 598
- 0
Báo cáo lâm nghiệp: "An analysis of ecophysiological responses to drought in American Chestnut" ppt
Ngày tải lên :
07/08/2014, 16:20
... Dudley J.B., Leaf abscisic acid accumulation in response to substrate water content: Linking leaf gas exchange regulation with leaf abscisic acid concentration, J Am Soc Hortic Sci 131 (2006) 295–301 ... environment such that water stressed environments would accelerate successful reintroduction of blight-resistant American chestnut hybrids Consequently, this aspect could significantly alter the current ... internal CO2 concentration (A−Ci curves, where A is net photosynthetic rate in µmol m−2 s−1 and Ci is internal CO2 concentration expressed as the mol fraction of CO2 ) was only determined on replicates...
- 10
- 302
- 0
Enhancement of tolerance development to morphine in rats prenatally exposed to morphine, methadone, and buprenorphine docx
Ngày tải lên :
10/08/2014, 05:21
... Chiang et al Journal of Biomedical Science 2010, 17:46 http://www.jbiomedsci.com/content/17/1/46 children may present long-term neuropsychological sequel caused by dysfunction in intellectual ... Pharmacol Biochem Behav 1996, 55:629-634 Chiang et al Journal of Biomedical Science 2010, 17:46 http://www.jbiomedsci.com/content/17/1/46 27 Bhat R, Chari G, Rao R: Effects of prenatal cocaine, ... classes of receptors that have opposing regulating functions on opioid-induced anti- Chiang et al Journal of Biomedical Science 2010, 17:46 http://www.jbiomedsci.com/content/17/1/46 nociception Their...
- 10
- 230
- 0
báo cáo khoa học: " Intein-mediated site-specific conjugation of Quantum Dots to proteins in vivo" pdf
Ngày tải lên :
11/08/2014, 00:22
... sequenced to verify correct coding pCS2++-Btk PH-EGFP-IN A PCR fragment amplified with IGpr62 (TGTACAGGCGCGCGTACGGCGGCGGCGGCGGCGGC AAGTTTGCGGAATA TTGCCTCAG) and IGpr64 (CGCGCG GC GGCCGCTTATTTAATTGTCCCAGCG) ... of the pCS2++ plasmid between the ClaI-EcoRI restriction sites A PCR fragment amplified with IGpr61 (AAGGAATTCAAGTTTGCGGAATATTGCCTCAGTTTTGG) and IGpr63 (AAGC TCGAGTTATTTAATTGTCCCAGCG) encoding ... Apr1 (AAGATCGATATGAGCGACGTGGCTATTG) and Apr3 (AAGGAATTCCTTGTACAGCTCGTCCATGCCGAG) encoding Akt PH-EGFP, using the pAkt PH-EGFP-N1 plasmid [13] as template, was inserted into the multiple cloning...
- 9
- 203
- 0
Báo cáo y học: " Criterion distances and environmental correlates of active commuting to school in children" pps
Ngày tải lên :
14/08/2014, 08:20
... difference on active commuting mode choice to school in children Among the active commuting children, bicycle use in children was positively associated with a longer household distance from school The ... dense network of cycle tracks (12.000 kilometers cycle tracks) make from Flanders a cycle-friendly region in which the prevalence of walking and cycling in general is much higher compared D’Haese ... wear bicycle helmets Mostly, bikes are stored at common places at school and theft is not a problem at elementary schools In conclusion, there is lack of age-specific criterion distances and, consequently,...
- 10
- 192
- 0
Báo cáo y học: " Lineage-specific expansion of proteins exported to erythrocytes in malaria parasites" doc
Ngày tải lên :
14/08/2014, 16:21
... ExportPred can accurately predict functional PEXEL motifs comment Figure (see previous page) ExportPred: Architecture and performance ExportPred: Architecture and performance (a) The architecture ... the Plasmodium falciparum proteome by high-accuracy mass spectrometry Nature 2002, 419:537- 542 Sanders PR, Gilson PR, Cantin GT, Greenbaum DC, Nebl T, Carucci DJ, McConville MJ, Schofield L, Hodder ... blood cell surface called knobs Knob-associated histidine-rich protein (KAHRP) is a structural knob component that anchors the major virulence factor Plasmodium falciparum erythrocyte surface protein...
- 22
- 265
- 0
Study on situation to overcome the consequences of toxic chemicals to humans in Cam Lo District, Quang Tri province
Ngày tải lên :
16/03/2015, 17:34
... the work of overcoming the consequence of toxic chemical influence on people in Cam Lo district, Quang Tri province Study objects and scope Study objects Victims of toxic chemicals, institution ... Hence, effects of the toxic chemicals on human being must be considered in the relation with all economic, social, cultural, and natural aspects The toxic chemicals cause serious consequences ... the toxic chemicals in Cam Lo district, Quang Tri province Conclusions and recommendations References Appendix 16 CHAPTER OVERVIEW ON THE STUDY OF OVERCOMING THE CONSEQUENCES OF TOXIC CHEMICALS/DIOXIN...
- 127
- 449
- 0
Antecedents of student SI to pacificipcip in extra curricular
Ngày tải lên :
15/04/2015, 16:30
... study The Cronbach alpha coefficients in Table 4-2 showed that measurement scales were reliable Table 4.2: Cronbach alpha coefficients Scale Mean if Scale Variance Corrected Item- Cronbach's Alpha ... “non-academic endeavors” (Chia, 2005) or “out-of-class experiences” (Nelson et al 2002) Extra-curricular activities in this study are defined as activities in the academic club, athletic club, ... The official scale 21 Table 3.2: Rules of Thumb about Cronbach Alpha Coefficient Size .24 Table 4.1: Demographic characteristics 29 Table 4.2: Cronbach alpha coefficients ...
- 85
- 334
- 1
thảo luận tiếng anh 1.5 VCU Topic Factors to consider in setting up a business
Ngày tải lên :
14/05/2015, 14:38
... between competitors is “cooperation” where two competitors both complete and cooperate with each other Complexity is due to the fundamentally different and contradictory logics of interaction that competition ... location goes long way in market the business successful The location needs to be carefully chosen Some places have advantage over the other You can save out on taxes, water and electricity costs ... everything will take twice as long and cost twice as much as you expect Figure that your worst-case scenario will occur, not your best-case Don't assume instant profitability, a common mistake of many...
- 14
- 737
- 0
Conversion of saline water to fresh water using air gap membrane distillation (AGMD)
Ngày tải lên :
11/09/2015, 09:57
... gas constant (J/K-mole) Re Reynolds Number Sc Schmidt Number T Temperature (K) t Thickness/width(m) U x-directional velocity (m/sec) V y-directional velocity (m/sec) v Velocity of different components ... the condensation surface, which results in lower permeate fluxes Compared to a DCMD process, an AGMD process provides the freedom of using any coolant as the coolant does not come in contact with ... Background xxi 1.1.1 MD process description 1.1.2 Classification of MD and process limiting factors 1.1.3 Advantages of MD 1.1.4 Areas of interest for MD research 1.2 Objectives 1.3 Chapter Scope...
- 248
- 646
- 0
Research study on the trends and patterns of corporate giving to charities in singapore
Ngày tải lên :
16/09/2015, 08:31
... public good.” (April 1982, p.34) Many diverse global companies such as General Electric, Procter & Gamble, IBM, Coco-Cola, Shell International Limited, America Express, Citigroup, have publicly ... new economy and its impact on corporate philanthropy Each of these factors will be discussed The Resurgence of Civil Society Initiatives Several researchers have attributed the resurgence of civil ... society initiatives, especially in the Western economies, to the growth of corporate philanthropy Changing expectations concerning corporate roles has led advocacy groups to demand for more social...
- 239
- 379
- 0