τ values fit for molality mean ionic activity coefficient data of aqueous electrolytes at 298 15 k
Curricular change in response to the 150 hour law for CPA exam candidates, a case study of business departments at three colleges
Ngày tải lên :
30/09/2015, 13:42
... to complete their education In addition to gathering background information on each of the participants, the demographic data form also served as corroborating support for data obtained during ... Lawmakers in a few states were finally convinced of the benefits of increased education for CPA Exam Candidates In the 1970’s, Hawaii and Florida passed legislation that required 150 hours of education ... passage of the CPA exam, and most require one to two years of work experience Currently, forty-five states have enacted legislation that mandates CPA exam candidates to complete 150 credit hours before...
- 236
- 778
- 0
Tài liệu Báo cáo khoa học: Characterization of the promoter for the mouse a3 integrin gene Involvement of the Ets-family of transcription factors in the promoter activity doc
Ngày tải lên :
21/02/2014, 03:20
... Laboratory Invest 69, 295–299 Kikkawa, Y., Umeda, M & Miyazaki, K (1994) Marked stimulation of cell adhesion and motility by ladsin, a laminin-like scatter factor J Biochem (Tokyo) 116, 862–869 Kikkawa, ... metastatic activity ACKNOWLEDGEMENTS We thank Dr Kensuke Suzuki (Pharmaceutical Frontier Research Laboratories, Japan Tobacco Inc.) for his helpful discussion We are also grateful Ms Nami Kawai ... (approximately 2.5 kb upstream of the SacI site) and XbaI (approximately 1.2 kb upstream of the SacI) sites (Fig 1) Fig Promoter activity of serial deletion constructs of the 5¢-flanking region of the...
- 9
- 562
- 0
Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf
Ngày tải lên :
07/03/2014, 05:20
... TGGACGGATATTGAAGCTGATCTCACCATAAAGGAT ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTG CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC ... C-terminal helix for Vps4p ATPase activity is evident from both ATPase activity assays and our finding that mutation of the C-terminal 1442 helix abrogates ATP-dependent dissociation of Vps20p–Vps4p ... dominant-negative effects of Vps4p–E233Q These data indicate that the contributions of the C-terminal helix and b domain to Vps4p oligomerization are distinct We also show that Vta1p promotes formation of...
- 23
- 490
- 0
Fit for GOLF pdf
Ngày tải lên :
18/03/2014, 01:21
... especially like to thank the Hjertstedt family and the Singh family for their hospitality And last I’d like to thank Jim Gorant for making this book happen Boris Kuzmic I wish to thank everyone at McGraw-Hill ... proper range of motion That way you’ll not only hit it well, but you’ll hit it far and in a way that reduces the chance of injury The Key Goal of Working Out A workout that isolates and attempts ... perform a round of static stretches Keep in mind a few basic principles: Whenever possible, perform stretches that work one muscle at a time and that isolate muscles In other words, instead of...
- 151
- 1.4K
- 1
Fit-City 2: Promoting Physical Activity through Design pptx
Ngày tải lên :
19/03/2014, 11:20
... expended because of our lack of physical activity We are therefore overusing external energy sources to compensate for that So instead of walking or biking, we rely on cars Instead of using the stairs, ... observed “You think of a building that hopefully is energy efficient, doesn't use a lot of water, maybe has recycled materials That's typically what's talked of and the stuff that's easier to grasp ... Chelsea’s meatpacking district, where a staircase takes center stage • ILLUSTRATION Elevator Line of Principal Path of Travel Border of Stair Effective Areas Visual Field of Stair Located further...
- 30
- 186
- 0
Báo cáo khoa học: Vibrio cholerae hemolysin Implication of amphiphilicity and lipid-induced conformational change for its pore-forming activity ppt
Ngày tải lên :
31/03/2014, 09:20
... volume of chloroform at 25 °C, vortexed for 10 to maximize the area of water–chloroform interface and allowed to separate The HlyA concentration in the aqueous phase was determined in triplicate ... the toxin at the interface of water and chloroform The ratio of the aqueous phase concentration of the HlyA following partitioning with chloroform, c to the initial value, co, estimated by the ... 10 mM sodium phosphate buffer containing 150 mM NaCl, pH 7.2 (NaCl/Pi) for h at 25 °C at a concentration of ngÆmL)1, corresponding to a specific activity of 60 pM Demonstration of protein amphiphilicity...
- 8
- 351
- 0
Báo cáo Y học: A critical motif for oligomerization and chaperone activity of bacterial a-heat shock proteins pot
Ngày tải lên :
31/03/2014, 21:21
... Chaperone activity and homoand hetero-oligomer formation of bacterial small heat shock proteins J Biol Chem 275, 37212–37218 14 Kim, K. K., Kim, R & Kim, S.H (1998) Crystal structure of a small heat-shock ... citrate synthase (CS) assay a-Hsp proteins were preincubated at 43 °C in mL of 50 mM sodium phosphate, pH 6.8, for at least 15 The assay was started by addition of CS to a final concentration of ... structure of a small heat-shock protein Nature 394, 595–599 15 Roy, S .K. , Hiyama, T & Nakamoto, H (1999) Purification and characterization of the 16-kDa heat-shock-responsive protein from the...
- 9
- 467
- 0
Báo cáo hóa học: " Development and application of a biomarker assay for determining the pharmacodynamic activity of an antagonist candidate biotherapeutic antibody to IL21R in whole blood" pptx
Ngày tải lên :
18/06/2014, 16:20
... incubated at 37°C for the indicated duration while mixing continuously at approximately 15 revolutions per minute using a Rotamix rotating mixer (ATR Inc, Laurel, MD) To investigate Ab01-mediated ... ranking in monkeys due to the lack of IFNγ and CD19 data in cynomolgus monkeys (for the reason detailed above) We conclude that the whole blood rhIL21 responses of human and monkey are remarkably ... that will be required upon hand-off for assay validation SJ, AW, SWA and KA performed the in vitro assays on monkeys treated with Ab-01 and control Ig and analyzed the data, and KA and SA performed...
- 13
- 528
- 0
Báo cáo toán học: " Sharp bounds for Seiffert mean in terms of root mean square" pot
Ngày tải lên :
20/06/2014, 21:20
... Seiffert mean and root mean square of a and b, respectively 2010 Mathematics Subject Classification: 26E60 Keywords: Seiffert mean; root mean square; power mean; inequality Introduction For a, b ... the Natural Science Foundation of China under Grant 11071069, the Natural Science Foundation of Hunan Province under Grant 09JJ6003 and the Innovation Team Foundation of the Department of Education ... bounds for Seiffert mean in terms of root mean square Yu-Ming Chu∗1 , Shou-Wei Hou2 and Zhong-Hua Shen2 1∗ Department of Mathematics, Huzhou Teachers College, Huzhou 313000, China Department of Mathematics,...
- 15
- 515
- 0
Báo cáo hóa học: " Research Article Two Sharp Inequalities for Power Mean, Geometric Mean, and Harmonic Mean" pptx
Ngày tải lên :
22/06/2014, 02:20
... identric mean and the power mean inequalities of Ky Fan type,” Facta Universitatis, no 4, pp 15 18, 1989 11 C O Imoru, “The power mean and the logarithmic mean, ” International Journal of Mathematics ... Seiffert’s mean and power means,” Mathematical a ¨ Inequalities & Applications, vol 7, no 1, pp 47–53, 2004 H Alzer and S.-L Qiu, “Inequalities for means in two variables,” Archiv der Mathematik, vol ... power means,” Mathematical Inequalities & Applications, vol 2, no 2, pp 175–181, 1999 J Bukor, J Toth, and L Zsilinszky, “The logarithmic mean and the power mean of positive numbers,” ´ Octogon Mathematical...
- 6
- 310
- 0
Báo cáo y học: " Identification of a novel motif responsible for the distinctive transforming activity of human T-cell leukemia virus (HTLV) type 1 Tax1 protein from HTLV-2 Tax2" pps
Ngày tải lên :
12/08/2014, 23:22
... cellular transformation Nat Rev Cancer 2007, 7:270-280 Giam CZ, Jeang KT: HTLV-1 Tax and adult T-cell leukemia Front Biosci 2007, 12:1496 -150 7 Takatsuki K: Discovery of adult T-cell leukemia Retrovirology ... 18 19 Acknowledgements We would like to thank Dr Hiroyuki Miyoshi at RIKEN Tsukuba Institute for providing the lentivirus plasmids We also wish to thank the Takeda Pharmaceutical Company for providing ... transformation, most likely through NF-κB2/p100 activation The cryptic NES region of Tax1 negatively regulates the transforming activity Thereafter, we examined the transforming activities of the...
- 11
- 548
- 0
Báo cáo y học: "Burns: learning from the past in order to be fit for the future" pps
Ngày tải lên :
13/08/2014, 20:21
... for 29% of all deaths – 83% of these were due to acute respiratory distress syndrome [1] Although the methods used for the management of acute respiratory distress syndrome have changed dramatically ... priority for initial management Advances in fluid management have led to a marked decrease in fatal burn shock and its related complications Williams and colleagues reported that shock accounted for ... Plastic Surg 2009, 36:527-545 Keck M, Herndon DN, Kamolz LP, Frey M, Jeschke MG: Pathophysiology of burns Wien Med Wochenschr 2009, 159 :327-336 Williams FN, Herndon DN, Jeschke MG: The hypermetabolic...
- 2
- 397
- 0
Báo cáo y học: " Adolescent girls’ and parents’ views on recruiting and retaining girls into an after-school dance intervention: implications for extra-curricular physical activity provision" ppsx
Ngày tải lên :
14/08/2014, 08:20
... committee at the University of Bristol and informed parental consent (for girls’ participation) and informed consent (for parental participation) were obtained for all participants Girls’ data collection ... dance as the activity of choice we have yielded key information that is likely to be of direct use to researchers or activity providers who may be designing physical activity programmes for adolescent ... of saturation where no new information was obtained in both the student focus groups and parental interviews We are therefore confident that the data presented here are an accurate representation...
- 9
- 367
- 0
Developing chemical biology approaches for the activity based investigations of reversible protein phosphorylation mediating enzymes
Ngày tải lên :
11/09/2015, 09:58
... first-generation kinase click inhibitors 79 2 The second-generation kinase click inhibitors 82 Kinase inhibition assays 84 Screening of the inhibitor library and generation of heat-map 84 IC50 evaluation of ... Chemical structures of ICAT reagents 1.4 Schematic representation of ICAT-MS-based protein quantification and identification strategy 1.5 Overview of Yeast two-hybrid assay 1.6 Schematic of ABPP showing ... of AfBPs and bidentate inhibitors of protein kinases with a compact gatekeeper residue 163 List of Figures Figure Page 1.1 Overview of Catalomics 1.2 Schematic representation of 2D-LC coupled to...
- 224
- 346
- 0
Design, optimization and structure activity relationship study of CD2 derived peptides for immunomodulation
Ngày tải lên :
04/10/2015, 15:46
... constant data for cQT peptide in water at 29 8K 116 Table 5-4 Chemical shift and coupling constant data for cIN peptide in water at 29 8K 118 Table 5-5 The backbone dihedral angles at R4 -K5 -E6 -K7 in ... temperature coefficients for S4A peptide in water at 29 8K 129 Table 5-10 The backbone dihedral angles in the conformation of peptide S4A 137 xii LIST OF FIGURES Figure 1-1 Molecular interactions at ... MD-based conformation of peptide cQT 121 Table 5-6 The backbone dihedral angles at D3-T4 -K5 -G6 in MD-based conformation of peptide cIN 122 Table 5-7 Chemical shift and coupling constant data for cVR...
- 173
- 322
- 0
Fit for purpose ageing cities
Ngày tải lên :
04/12/2015, 00:09
... a sales boost as a result of applying for an “age-friendly” designation and receiving folding seats They also need to agree to offer regular glasses of water Lists of age-friendly swimming pools ... Smart Employer (ASE) awards, defined on the basis of perks such as flexible working, training and professional development for older people, and initiatives such as mutually beneficial mentoring This ... how to offer personal service and foster relationships with customers The ASE awards are being funded by the Alfred P Sloan Foundation, which was set up in 1934 by a former president of General...
- 2
- 228
- 0
Fit for purpose designed for life
Ngày tải lên :
04/12/2015, 00:09
... emeritus professor of construction management at Reading University, two main theories of hospital design are now emerging The first involves a “cheap and cheerful” office block to be used for patient ... be used for patient accommodation and administrative space Such buildings, incorporating simple innovations such as natural air flow and window views for bedridden patients, would be erected alongside ... generation of new hospitals in the UK—when it begins—will benefit from better thinking about the future of healthcare, says Mr Whittlestone Yet it will still require hard political decision-making...
- 2
- 289
- 0
Fit for purpose gaming healthcare
Ngày tải lên :
04/12/2015, 00:09
... Proteus Digital Health of Redwood City, California “The Helius will quickly show when treatment is ineffective.” Ultimately, improving the take-up of many of these initiatives will require more ... take-up of the device may be good news for patients, it may not be entirely good news for drug manufacturers: “It is very common for drugs designed to prevent high blood pressure not to work at ... messages to remind patients to take their medication, with monitors that can even be attached to lavatories or medication dispensers The technology is not just being used for drugs A brain-training...
- 2
- 130
- 0
Fit for purpose healthy green cities
Ngày tải lên :
04/12/2015, 00:09
... it is their tenants who benefit in the form of lower energy bills And property owners may find it hard to switch their buildings to cleaner forms of energy, such as natural gas, if utility companies’ ... methodology that measures the emissions associated with cities’ economic activity and consumption, and is training city officials and corporate executives to use the methodology as a planning tool Meanwhile, ... governments also need to create the right incentives for the corporate sector to invest “We have to bring utility companies into the debate to discuss how they might online billing for renewable energy...
- 2
- 286
- 0
Fit for purpose the data revolution
Ngày tải lên :
04/12/2015, 00:10
... who is at risk, what types of risks there are, and what is the propensity of different patients to respond to different forms of intervention.” Improving outcomes With governments looking to ... with patients suffering from chronic conditions such as diabetes or high blood pressure Future health data miners may look to enhance existing patient data with broader data from social networking ... enormous volumes of data in order to learn more about disease management and treatment and engage with patients The most lucrative prospects for big data are in the evolving field of personal medicine,...
- 2
- 194
- 0