δ by ce0 8gd0 2o2 δ to form a dual phase composite membrane for oxygen separation from air
Statistical methods for the detection and analyses of structural variants in the human genome
... 11 rapidly changing technologies Already, there is a great demand for information technology infrastructure and bioinformatics team to analyse the massive amount of data, with speculations that ... yxnj} as the set of log2-intensity ratios from platform j We write our model as ( ) , where f is a random effects parameter that is common to all platforms, meaning that each platform is assumed to ... main reasons: the raw data are readily available and there are several studies which have characterized the CNV profiles for these individuals and often used as the „gold standard‟ (Kidd et al.,...
- 171
- 567
- 0
Báo cáo khoa học: Structure–activity relation for synthetic phenoxazone drugs Evidence for a direct correlation between DNA binding and pro-apoptotic activity pdf
... calculated for mol base pairs, taking an average molecular mass of a DNA base pair as 660 Da Results Dose-dependent apoptosis and cell cycle in the drug-treated leukemia cells The biological activity ... Table Binding parameters for ActII/ActV drug–DNA complexation, calculated per mol of ligand at r = 0.33 (ratio of moles of bound ligand to moles of base pairs) Values are mean ± average deviation ... than the mean value for DHbind for complex formation for ActIII–ActV with DNA Assuming that the nature of intercalation with DNA is similar for all the drugs investigated, then the additional...
- 8
- 331
- 0
Báo cáo y học: "Direct electrochemical analyses of human cytochromes b5 with a mutated heme pocket showed a good correlation between their midpoint and half wave potentials" doc
... (5’-CCTCAAAGTTCTCAGTAACGTCACCTCCAGCTTG-3’) and A5 9V-F (5’-CAA GCTGGAGGTGACGTTACTGAGAACTTTGAGG-3’); for A5 9 S, A5 9S-R (5’-CAAGCTGGAGGTGACTCTACTGAGAACTTTGAGG-3’) and A5 9S-F (5’-CA AGCTGGAGGTGACTCTACTGAGAACTTTGAGG3’); for G6 7A, G6 7A- R(5’-GGCATCTGTAGAGTGCGCGACATCCTCAAAGTTC-3’) ... G6 7A- R(5’-GGCATCTGTAGAGTGCGCGACATCCTCAAAGTTC-3’) and G6 7A- F (5’-GAAC TTTGAGGATGTCGCGCACTCTACAGATGCC-3’); and for G67 S, G67S-R (5’-GGCATCTGTAGAGTGCGAGACATCCTCAAAGTTC-3’) and G67S-F (5’-GAA CTTTGAGGATGTCTCGCACTCTACAGATGCC-3’) ... (5’-GGTGGGGAAGAAGTTATCAGGGAACAAGCTGG-3’); for L51T, L51T-R (5’-CCAGCTT GTTCCCTTGTAACTTCTTCCCCACC-3’) and L51T-F (5’-GGTGGGGAAGAAGTTACAAGGGAACAAGCT GG-3’); for A5 9V, A5 9V-R (5’-CCTCAAAGTTCTCAGTAACGTCACCTCCAGCTTG-3’) and...
- 15
- 477
- 0
báo cáo khoa học: " A hypothetical correlation between hyaluronic acid gel and development of cutaneous metaplastic synovial cyst" potx
... General Hospital, Bari, Italy, 3Department of "Head and Neck Diseases", Hospital "Fatebenefratelli", Rome, Italy, 4Department of Maxillofacial Surgery, Calabrodental, Crotone, Italy, 5Department ... trauma usually precedes its onset Synovial-like metaplasia associated with prostheses and breast implant capsules has also been reported and may occur in postsurgical cutaneous scars, which are ... believed to be low, and the vast majority of them represent a foreign body-related chronic inflammatory reaction The cause of formation of cutaneous metaplastic synovial cysts remains unclear, but...
- 3
- 292
- 0
Báo cáo y học: "Association between copy number variation of complement component C4 and Graves’ disease" ppsx
... particular run Statistical analysis Statistical analysis was performed using the statistical package PASW for Windows (version 18.0; SPSS Inc.) The demographics of patients and healthy individuals ... DNA extraction and quantification gene dosage of C 4A and C4B Genomic DNA was extracted from peripheral blood following the manufactory’s suggestions (Qiagen) C4 gene dosage was assessed by quantitative ... was conducted to obtain demographics (age and gender); treatment and clinical features are summarized in Table For the healthy individuals, those with matched for gender according to the female...
- 8
- 350
- 0
báo cáo khoa học: " Ethical issues raised by common copy number variants and single nucleotide polymorphisms of certain and uncertain significance in general medical practice" potx
... medicolegal context, the availability of carrier testing and prenatal diagnosis for some forms of deafness could lead to an obligation to inform couples of this [18] Perhaps it is reassuring that, to ... disorders and carrier testing, there is no evidence that ancestry testing by SNPs has greater medical value than the information available from history and physical exami ation Testing for risk ... Beaudet AL: Clinical use of array comparative genomic hybridization (aCGH) for prenatal diagnosis in 300 cases Prenat Diagn 2009, 29:29-39 Page of 24 Jancar J, Johnston SJ: Incest and mental handicap...
- 6
- 307
- 0
A Contrastive Analysis between the Verb ‘Run’ in English and the Verb ‘Chạy’ in Vietnamese
... singular form (of a noun of a particular class), and ‘teachers’ is plural form (of a noun of a particular class); and the difference between singular forms and plural form is semantically relevant: ... ‘runaway’ (an airstrip, strip of pavement on which airplanes take off and land); ‘hit-and-run’ (automobile accident in which a driver who hits a pedestrian or a car drives off to avoid taking ... controlling/running a relief operation in the Sudan - If you want to manage somebody, manage yourself Do that well and you'll be ready to stop managing And start leading (4) With regard to the state of having a...
- 52
- 1,860
- 25
Tài liệu Báo cáo khoa học: The crystal structure of human a-amino-b-carboxymuconatee-semialdehyde decarboxylase in complex with 1,3-dihydroxyacetonephosphate suggests a regulatory link between NAD synthesis and glycolysis ppt
... only a key precursor of NAD, but also a potent neurotoxin that acts by activating the N-methyl-d-aspartate subtype receptor for glutamate [4] QA imbalance was reported to be associated with a number ... potential interest to reduce life-threatening complications of cerebral malaria, and as an important tool in validating our proposal of hACMSD as a novel drug target for the treatment of diabetes and ... hepatic a- amino-b-carboxymuconate-e-semialdehyde decarboxylase, a key enzyme in the tryptophan–nicotinamide adenine dinucleotide pathway, by hepatocyte nuclear factor 4a and peroxisome proliferator-activated...
- 9
- 796
- 0
Báo cáo khoa học: Interaction between Lim15/Dmc1 and the homologue of the large subunit of CAF-1 – a molecular link between recombination and chromatin assembly during meiosis pot
... Koshiyama A, Hamada FN, Namekawa SH, Iwabata K, Sugawara H, Sakamoto A, Ishizaki T & Sakaguchi K (2006) Sumoylation of a meiosis-specific RecA homolog, Lim15/Dmc1, via interaction with the small ... (2001) The Rad51 and Dmc1 recombinases: a non-identical twin relationship Trends Biochem Sci 26, 131–136 Namekawa SH, Iwabata K, Sugawara H, Hamada FN, Koshiyama A, Chiku H, Kamada T & Sakaguchi K ... TGTCGGGAGCAGATTCA; 381R, 5¢-TGCTACTTCTC TCAGCGGCCGCATTCTTAT CcCac1L-C: 382F, 5¢-CA TGCCATGGTGTCAGGGGATGTAGAAATG; 812R, 5¢-GAGATTTCAGTTTCGTCACTCGAGCGG To overexpress N-terminal hexahistidine-tagged...
- 10
- 487
- 0
Báo cáo khoa học: "Augmented Dependency Grammer: A Simple Interface between the Grammer Rule and the Knowledge" pptx
... hierarchy for concept generalization Atomic f o r m u l a i n FTABLE and THESAURUS Knowledge Base consists of LEXICON, THESAURUS and FTABLE The case grammar, as a basis of internal representation, ... combination of binary case relations, fits the dependency grammar very well, since both dependency and case relation are basically binary The dependency analysis also correlates to the atomic formula ... pragmatic and temporal information Ordinary analysis of SENI produces subject-predicate-object syntagmatic information, and further case interpretaion of subject-predicate,object-predicate relations...
- 7
- 373
- 0
Báo cáo khoa học: Correlation between conformational stability of the ternary enzyme–substrate complex and domain closure of 3-phosphoglycerate kinase potx
... 1875 Substrate-assisted domain–domain cooperativity A Varga et al ˚ Table Atomic contacts responsible for domain cooperation Atomic distances (A- s) were measured in the interdomain region and its ... Substrate-assisted domain–domain cooperativity A Varga et al Table The activation parameters of thermal transitions of pig muscle and yeast PGKs The values of DHà (kcalÆmol)1) and DSà (calÆmol)1) ... experimental data are scarce [19,20,76], no systematic comparison has been made in the various binary and ternary enzyme–substrate complexes Separated DSC transitions attributable to the individual...
- 19
- 460
- 0
HOW TO BRIDGE THE DISTANCE BETWEEN BUSINESS STRATEGY AND DESIGN.A VISUAL PRESENTATION BY MARTY potx
... brand-building READY? LET’S START BY DISPELLING SOME MYTHS FIRST A brand is not a logo SECOND A brand is not an identity X FINALLY A brand is not a product So what exactly is a brand? A BRAND ... STRATEGIC TOOL SINCE THE SPREADSHEET PROBLEM In most companies, STRATEGY is separated from CREATIVITY by a wide gap On one side of the gap are STRATEGIC THINKERS ANALYTICAL LOGICAL LINEAR NUMERICAL ... build a charismatic brand A CHARISMATIC BRAND is any product, service, or organization for which people believe there’s no substitute QUIZ : Which of these brands are charismatic? AMAZON HITACHI...
- 162
- 460
- 0
![Báo cáo khoa học: A dimer of the FeS cluster biosynthesis protein IscA from cyanobacteria binds a [2Fe2S] cluster between two protomers and transfers it to [2Fe2S] and [4Fe4S] apo proteins ppt](https://media.store123doc.com/images/document/14/rc/tl/small_tlm1396203606.jpg)
Báo cáo khoa học: A dimer of the FeS cluster biosynthesis protein IscA from cyanobacteria binds a [2Fe2S] cluster between two protomers and transfers it to [2Fe2S] and [4Fe4S] apo proteins ppt
... 5¢-GTAGGACATGCCAGAggcGCCCCCTTG ACG-3¢, MOslr1417-3 5¢-GCAAACTTTTCCGaTCGgc GATAATCTGAAAACC-3¢, MOslr1417-4 5¢-GGAT TTACCACAACCAgctGTTTGATTAGCATT-3¢ and MOslr1417-5 5¢-CCAAAGGATTTACCggcgCCACAGG ... slr1417 was amplified from chromosomal DNA of Synechocystis PCC 6803 by PCR using the primers PRiscA11 (5¢-GGAATTCCATATGAGCCAAGCCACC GCTACC-3¢) and PRiscA12 (5¢-GATCTAAGCTTAAA CCCCAAAGGATTTACC-3¢) ... 16 Kaneko, T., Sato, S., Kotani, H., Tanaka, A. , Asamizu, E., Nakamura, Y., Miyajima, N., Hirosawa, M., Sugiura, M., Sasamoto, S., Kimura, T., Hosouchi, T., Matsuno, A. , Muraki, A. , Nakazaki,...
- 10
- 447
- 0
Báo cáo khoa học: Insights into the design of a hybrid system between Anabaena ferredoxin-NADP+ reductase and bovine adrenodoxin pot
... typical absorbance band at 450 nm [33] Time-sequential spectra recorded after addition of CYP1 1A1 to an anaerobic CO-saturated sample containing the reaction mixture FNRrd/Adxox gave rise to a peak ... obtained are not able to adopt orientations between the redox cofactors that would allow both ET rates as fast as those obtained with the physiological partners, and/or conformational changes and ... M., De la Rosa, M .A & Tollin, G (1992) A comparative laser-flash absorption spectroscopy study of algal plastocyanin and cytochrome c552 photooxidation by photosystem I particles from spinach Eur...
- 10
- 400
- 0
báo cáo hóa học: " Evaluation of adaptation to visually induced motion sickness based on the maximum cross-correlation between pulse transmission time and heart rate" docx
... population and medical cost inflation In Japan in 2006, a new law regarding the national health was passed and it fixes a months limit to the coverage for rehabilitation programs For this reason, ... (in Japanese) Sugita N, Yoshizawa M, Tanaka A, Abe K, Yambe T, Nitta S, Chiba S: Biphasic Response of Autonomic Nervous System to Visually-Induced Motion Sickness Trans Virtual Reality Japan 2004, ... pressure and heart rate J Human Interface Japan 2002, 4(4):39-46 (in Japanese) Kennedy RS, Lane NE: Simulator sickness questionnaire: An enhanced method for quantifying simulator sickness Int J Aviat...
- 6
- 534
- 0
Báo cáo hóa học: " The correlation between radiative surface defect states and high color rendering index from ZnO nanotubes" docx
... compared to nanorods These originated surface defect states can act as additional radiative recombination centers and it is also a wellknown fact that the presence of surface defect states is always ... UV could be assigned to the entrance of the electron beam into the nanotube where it can travel adopting a helical path by striking again and again with the inner surface of the nanotube Secondly, ... film Adv Mater 2009, 21:2767-2770 10 Tsukazaki A, Ohtomo A, Onuma T, Ohtani M, Makino T, Sumiya M, Ohtani K, Chichibu SF, Fuke S, Segawa Y, Ohno H, Koinuma H, Kawasaki M: Repeated temperature...
- 5
- 285
- 0
Báo cáo sinh học: "A balancing act between the X chromosome and the autosomes" ppsx
... that has three copies in Dp/+ flies and one in Df/+ flies) female soma and gonads; that is, the expression ratios between X chromosomes and autosomes of XX;AA female soma and X;AA male soma centered ... sexes are hypertranscribed relative to autosomes, but also that the two X chromosomes of females are repressed, as the expression ratios of not only testes (X;AA) but also XX;AA ovaries and X;AA ... X-linked partner would Expression level 1.5 X X A X A X 0.5 X A A X X X A A X Xa A X A X A X Xi Soma Germline Drosophila Soma C elegans Soma Germ cells Mammals Figure Dosage compensation occurs...
- 3
- 315
- 0
Báo cáo y học: " A rigid barrier between the heart and sternum protects the heart and lungs against rupture during negative pressure wound therapy" doc
... wound was treated with NPWT in the presence or absence of a Calculations and statistical analysis were performed using GraphPad 5.0 software (San Diego, CA, USA) Statistical analysis was performed ... ketamine (Ketaminol® vet 100 mg/ml; Farmaceutici Gellini S.p .A. , Aprilia, Italy; 20 mg/kg) Before surgery, a tracheotomy was performed and an endo-tracheal tube was inserted Anesthesia was maintained ... coronary artery bypass grafting at a tertiary care medical center Semin Thorac Cardiovasc Surg 2004, 16(1):53-61 Lu JC, Grayson AD, Jha P, Srinivasan AK, Fabri BM: Risk factors for sternal wound...
- 5
- 321
- 0
Báo cáo y học: "a diagnostic dilemma between psychosis and post-traumatic stress disorder: a case report and review of the literature" ppsx
... reactive She described vivid and clear auditory and visual hallucinations and persecutory delusions Her medical psychiatric, personal, and family histories were unremarkable A physical examination, ... case of a Vietnam veteran with a history of PTSD symptoms and psychotic symptoms including auditory hallucinations, visual hallucinations, thought disorder and paranoid ideation He had a history ... establishment of a good doctor-patient relationship This biopsychosocial approach was made to integrate all aspects relating to his history in a meaningful way [3] In our case report, our patient...
- 5
- 407
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25