ïfunction does not always return a valueó

Why Copying LIS from a Developed Country Does Not Work for a Developing Country?

Ngày tải lên : 18/10/2013, 14:15

... that it is so in practice Accordingly developing countries may require a more complex approach to an LIS than the relatively simple use of the LIS in many developed countries SUMMARY (Vietnamese) ... Pharaohs to Geoinformatics FIG Working Week 2005 and GSDI-8 Cairo, Egypt April 16-21, 2005 ộ TS – Applied SIM and SDI Trung Tran and Don Grant TS9.6 Why Copying LIS from a Developed Country Does ... and social implications The LIS suitable for developing countries must be capable of providing a sound base for economic and environmental planning This is certainly the theory...

2
422
0

Báo cáo khoa hoc:" Perigraft air is not always pathological: a case report" docx

Ngày tải lên : 11/08/2014, 10:22

... negative, and inflammatory markers remained within normal limits As the patient was now apyrexial and continued to be asymptomatic, the decision was made to discharge the patient A repeat CT scan performed ... reconstructive aortic surgery, performing a CT scan at 7, 48 and 102 days post-operatively Only patients had perigraft air at days, and this air had completely resolved by day 28 O'Hara et al looked at 26 ... patients, scanning them on days 3, and 52 Seventeen patients had perigraft air on day 3, and seven on day No patient had residual perigraft air on the final scan There is however no data regarding...

3
280
0

Báo cáo y học: "Marked increase of procalcitonin after the administration of anti-thymocyte globulin in patients before hematopoietic stem cell transplantation does not indicate sepsis: a prospective study" pptx

Ngày tải lên : 13/08/2014, 16:20

... (Modular SWA) was also used for analyses of alanin amino-transferase (ALT), gammaglutamyl transferase (GGT), and bilirubin to assess liver function and of urea, creatinine, and glomerular filtration ... lymphoma (8%) Hodgkin disease (4%) Age at ATG treatment, years Mean (minimum, maximum) Statistical analysis The plasma concentrations of biochemical markers are reported as mean ± standard deviation ... for citation purposes) Critical Care Vol 13 No Brodska et al Table Interrelationship of procalcitonin and other measured laboratory parameters Procalcitonin r Baseline Day Day Day Day Day CRP...

7
262
0

Báo cáo y học: "Extravascular lung water index measurement in critically ill children does not correlate with a chest x-ray score of pulmonary edema" docx

Ngày tải lên : 13/08/2014, 20:22

... standard way and sent to the laboratory for routine evaluation We calculated the P/F ratio and the alveolar arterial oxygen gradient (A- a gradient) using standard formula and a respiratory quotient ... Germany) In this way all thermodilution curves and hemodynamic data were stored automatically for analysis afterwards The software also stores the basic measurements that are needed for calculating ... Hoeft A, Buhre W: Assessment of cardiac output, intravascular volume status, and extravascular lung water by transpulmonary indicator dilution in critically ill neonates and infants J Cardiothorac...

11
326
0

Báo cáo y học: "Correction: Extravascular lung water index measurement in critically ill children does not correlate with a chest x-ray score of pulmonary edem" doc

Ngày tải lên : 13/08/2014, 21:21

... et al Critical Care 2010, 14:430 http://ccforum.com/content/14/4/430 Page of Table Patient characteristics per patient Diagnosis Length of PICU stay (days) Ventilator days Probability of death ... Reconstruction of pulmonary artery 2 survived M 4.4 VSD repair 13 26 survived 10 M 36 15.0 Meningococcal disease survived 11 M 9.0 Meningococcal disease survived 12 F 14 10.0 Meningococcal disease 28 survived ... Abdominal surgery 78 17 survived F 8.5 RSV 16 15 11 survived F 31 16.0 Meningococcal disease 22 19 survived F 4.8 Arterial switch operation 13 10 39 survived F 7.1 Tetrology of Fallot repair 16...

2
361
1

Báo cáo khoa học: Trigger factor interacts with the signal peptide of nascent Tat substrates but does not play a critical role in Tat-mediated export pptx

Ngày tải lên : 07/03/2014, 16:20

... pC4Meth-100TorA/P2 was constructed by PCR, using pTorA/P2 [17] as a template and the primers RRTorA-SacI-fw (5¢-GCGCGGAGCTCAAGAAGGA AGAAAAATAATGAAC-3¢, SacI site underlined) and TorA/Lep2-BamHI-rv (5¢-GCATGGATCCCGCGCGC ... 51SufI-BamHI-rv (5¢-ACGCGGATCCAG TCATAAACAGCGGTTGC-3¢, BamHI site underlined), 87SufI-BamHI-rv (5¢-ACGCGGATCCAACATCGTCGC CCTTCCA-3¢, BamHI site underlined) and SufIHAXbaI+ClaI-rv (5¢-ACTGATCGATCTAGATTACGCAT ... Tat apparatus FEBS Lett 534, 156–160 Miller, J.H (1992) A short course in bacterial genetics: A laboratory manual and handbook for Escherichia coli and related bacteria Cold Spring Harbor Laboratory...

9
393
0

Báo cáo khoa học: Lack of stabilized microtubules as a result of the absence of major maps in CAD cells does not preclude neurite formation pot

Ngày tải lên : 23/03/2014, 05:22

... GTTGGTCTCGTCGCTCATCACATCACGAGG GCTTGAAGGCGCTGGATCTGCGACAATAG GACTGGGCTTTCATCAGCGACAGGTGGC GTGAACCACCAAAATCGGAGAACGAAGC CAGGTTCTCAGTAGAGCCAATCTTCGACCTGAC AGAGTCGGATGCAGTTGCCCGGGCAACA GGCTCCTCCAGCACCCTCCGGGTCCCG ... GGCTCCTCCAGCACCCTCCGGGTCCCG CCCCAAACTTGTGACCATCATTC GGAGAAATCATCTTGAGCATAGCG CGAACTCTCAAGGGC ATGCATCAGAACCATGCACG AGCCCTACAATTCCATCCTCACC GCTGAAGGAGACGATGAGGGTGA 82898–82923 83581–83552 91489–91517 ... no MAP band was observed (not shown) Gene and mRNA analyses of MAP1b, MAP2, Tau, and STOP The ﬁnding that apparently normal neurites are formed even when CAD cells lack MAP1b, MAP2, Tau, and...

14
416
0

Báo cáo sinh học: " Insertion of the human sodium iodide symporter to facilitate deep tissue imaging does not alter oncolytic or replication capability of a novel vaccinia virus" pptx

Ngày tải lên : 18/06/2014, 19:20

... and was critical to study design and completion All authors have read and approved the final manuscript Author disclosure statement Nanhai G Chen, Qian Zhang, Yong A Yu, and Aladar A Szalay are ... novel cancer treatment modality that several phase I and II trials are already underway Oncolytic vaccinia virus (VACV) strains have been of particular interest due to several advantages VACV’s ... imaging does not alter oncolytic or replication capability of a novel vaccinia virus Dana Haddad1,2†, Nanhai G Chen3†, Qian Zhang3, Chun-Hao Chen2, Yong A Yu3, Lorena Gonzalez2, Susanne G Carpenter2,...

14
490
0

Báo cáo hóa học: "Short-term locomotor adaptation to a robotic ankle exoskeleton does not alter soleus Hoffmann reflex amplitude" doc

Ngày tải lên : 19/06/2014, 08:20

... induce an alteration of reflex responses during human walking, it would have considerable potential as an aid for gait rehabilitation in addition to reducing manual assistance from the therapists ... exoskeleton assistance during walking may occur in two phases, a quick adaptation that occurs in the first few hours or days and a much longer adaptation that continues for weeks [60-62] The two adaptation ... managed data collections, completed data analysis and drafted the manuscript CLL developed a custom-written program to control the timing of electrical stimuli, assisted with data analysis and...

8
348
0

báo cáo hóa học: " Interleukin-1 receptor 1 knockout has no effect on amyloid deposition in Tg2576 mice and does not alter efficacy following Aβ immunotherapy" pot

Ngày tải lên : 19/06/2014, 22:20

... beta antibody alters CNS and plasma A beta clearance and decreases brain A beta burden in a mouse model of Alzheimer's disease Proc Natl Acad Sci U S A 2001, 98(15):8850-8855 Dodart JC, Bales ... experimental autoimmune encephalitis (EAE) and nasal vaccination with glatiramer acetate reportedly decrease amyloid plaques in APP transgenic mice [48] Another report by the same group shows that, ... indicate that there is the potential of exacerbation of cerebral-amyloid angiopathy (CAA) associated microhemmorhages in certain mouse strains following passive immunization with certain anti -A antibodies...

13
410
0

báo cáo hóa học:" Insertion of the human sodium iodide symporter to facilitate deep tissue imaging does not alter oncolytic or replication capability of a novel vaccinia virus" potx

Ngày tải lên : 20/06/2014, 03:20

... and was critical to study design and completion All authors have read and approved the final manuscript Author disclosure statement Nanhai G Chen, Qian Zhang, Yong A Yu, and Aladar A Szalay are ... novel cancer treatment modality that several phase I and II trials are already underway Oncolytic vaccinia virus (VACV) strains have been of particular interest due to several advantages VACV’s ... imaging does not alter oncolytic or replication capability of a novel vaccinia virus Dana Haddad1,2†, Nanhai G Chen3†, Qian Zhang3, Chun-Hao Chen2, Yong A Yu3, Lorena Gonzalez2, Susanne G Carpenter2,...

14
393
0

báo cáo hóa học:" Sexual behaviour does not reflect HIV-1 prevalence differences: a comparison study of Zimbabwe and Tanzania" ppt

Ngày tải lên : 20/06/2014, 08:20

... Calverton, Maryland: Central Statistical Office and Macro International Inc; 2000 19 National Bureau of Statistics [Tanzania] and Macro International Inc: Tanzania Reproductive and Child Health ... 2005-06 Calverton, Maryland: Central Statistical Office and Macro International Inc; 2007 Page of 21 National Bureau of Statistics [Tanzania] and ORC Macro: Tanzania Demographic and Health Survey ... paediatric AIDS in Rwanda AIDS 1992, 6:1515-1520 38 Prazuck T, Tall F, Nacro B, Rochereau A, Traore A, Sanou T, Malkin JE, ApaireMarchais V, Masson D, Dublanchet A: HIV infection and severe malnutrition:...

9
449
0

Báo cáo khoa học: " Exposure to genistein does not adversely affect the reproductive system in adult male mice adapted to a soy-based commercial diet" potx

Ngày tải lên : 07/08/2014, 18:20

... PHGPx and GAPDH were 462 and 302 bp, respectively The relative absorbance of specific mRNA was normalized to the relative absorbance of GAPDH mRNA Statistical analysis Data were analyzed using SAS ... 10% and artificial illumination of a 12-hr light-dark cycle All animals received humane care as outline with “Guide for the care and use of animals” (Chungbuk National University Animal Care ... (MAD: time-average of absolute values of the instantaneous turning angle of the sperm head along its curvilinear trajectory), lateral head displacement (ALH: displacement of the centroid from a...

8
343
0

Báo cáo khoa học: "A pre-operative elevated neutrophil: lymphocyte ratio does not predict survival from oesophageal cancer resection" pps

Ngày tải lên : 09/08/2014, 03:21

... local database for oesophageal cancer Demographic details, pre-operative staging data, operation type, histopathological diagnosis, staging and survival were extracted from the database Pathological ... would be assessed against standard clinical and histopathological data Page of 10 Table Demographics and preoperative haematology results from patients with resected oesophageal cancer Demographics ... vascular and cardiovascular diseases [17,18] All patients undergoing oesophagectomy have preoperative full blood counts taken routinely The NLR can be calculated easily from the data already available...

10
224
0

Báo cáo y học: "Systemic TNF blockade does not modulate synovial expression of the pro-inflammatory mediator HMGB1 in rheumatoid arthritis patients – a prospective clinical study" ppt

Ngày tải lên : 09/08/2014, 10:23

... Huntsville, AL USA) The primer sequences used were: for β-actin, forward CCTTCGTGCCCCCCC and reverse GGAGAC- CAAAAGCCTTCATACATC; and for HMGB1, forward ATTGGTGATGTTGCGAAGAA and reverse GATCCACAGCAACTCCAGAA ... Taniguchi N, Kawahara K, Yone K, Hashiguchi T, Yamakuchi M, Goto M, Inoue K, Yamada S, Ijiri K, Matsunaga S, Nakajima T, Komiya S, Maruyama I: High mobility group box chromosomal protein plays a role ... immunohistochemical stainings and the immunohistochemical analysis JL performed the RT-PCR and mRNA analysis ES, CG, UA and HEH prepared the manuscript All authors read and approved the final manuscript Acknowledgements...

8
529
0

Báo cáo y học: "issed opportunities for participation in prevention of mother to child transmission programmes: Simplicity of nevirapine does not necessarily lead to optimal uptake, a qualitative stud?" pdf

Ngày tải lên : 10/08/2014, 05:20

... Providing a regimen that starts early in pregnancy should also be feasible as South Africa has an antenatal attendance rate of 90% and a mean number of ANC visits greater than three[10] Page of (page ... (Weliswa Binza, Vuyo Magasana, Pumza Mbenenge, Thantaswa Mbenenge, Thoko Ndaba, Nokuthula Radebe), the staff at the ARV clinics and all the respondents References Bradshaw D, Bourne D, Nannan N: What ... regions of South Africa with a poorly resourced health system and an antenatal HIV prevalence of 28%[12] Site C, is a periurban area with an antenatal prevalence of 41% [12] and an moderately well...

5
426
0

Báo cáo y học: " Solitary Peutz-Jeghers type hamartomatous polyps in the duodenum are not always associated with a low risk of cancer: two case reports" pptx

Ngày tải lên : 10/08/2014, 23:21

... a hamartomatous polyp with a focus of well-differentiated adenocarcinoma, and Case was a hamartomatous polyp with Table Twenty-seven cases of solitary duodenal Peutz-Jeghers type hamartomatous ... Peutz JLA: Very remarkable case of familial case of polyposis of mucous membrane of intestinal tract and nasopharynx accompanied by peculiar pigmentations of skin and mucous membrane Ned Maandschr ... 1921, 10:134-146 Acea Nebril B, Taboada Filgueira L, Parajó Calvo A, Gayoso Garc a R, Gómez Rodríguez D, Sánchez González F, Sogo Manzano C: Solitary hamartomatous duodenal polyp; a different entity:...

4
458
0

Báo cáo y học: " Loss of function mutation in toll-like receptor-4 does not offer protection against obesity and insulin resistance induced by a diet high in trans fat in miceg" pdf

Ngày tải lên : 11/08/2014, 03:20

... 174:5390-5397 Suganami T, Tamimoto-Koyama K, Nishida J, Iroh M, Yuan X, Mizuarai S, Kotami H, Yamaoka S, Miyake K, Aoe S, Kamei Y, Ogawa Y: Role of the tolllike receptor 4/NF- kappa B pathway in saturated ... Takeda K, Kaisho T, Akira S: Toll-like receptors Annu Rev Immunol 2003, 21:335-376 Tsukumo DM, Carvalho-Filho MA, Carvalheira JB, Prada PO, Hirabara S, Schenka AA, Araujo EP, Vassallo J, Curi ... 13.5 60.0 Data Analysis Data were presented as mean ± SD of mean The effect of genotype (WT and TLR4 mutant) within the diet (LF and TF) was assessed with a 2-way analysis of variance (genotype ×...

7
272
0

Báo cáo y học: "Loss of function mutation in toll-like receptor-4 does not offer protection against obesity and insulin resistance induced by a diet high in trans fat in mice" docx

Ngày tải lên : 11/08/2014, 06:22

... 174:5390-5397 Suganami T, Tamimoto-Koyama K, Nishida J, Iroh M, Yuan X, Mizuarai S, Kotami H, Yamaoka S, Miyake K, Aoe S, Kamei Y, Ogawa Y: Role of the tolllike receptor 4/NF- kappa B pathway in saturated ... Takeda K, Kaisho T, Akira S: Toll-like receptors Annu Rev Immunol 2003, 21:335-376 Tsukumo DM, Carvalho-Filho MA, Carvalheira JB, Prada PO, Hirabara S, Schenka AA, Araujo EP, Vassallo J, Curi ... 13.5 60.0 Data Analysis Data were presented as mean ± SD of mean The effect of genotype (WT and TLR4 mutant) within the diet (LF and TF) was assessed with a 2-way analysis of variance (genotype ×...

7
238
0

Báo cáo y học: "Prior exposure to an attenuated Listeria vaccine does not reduce immunogenicity: pre-clinical assessment of the efficacy of a Listeria vaccine in the induction of immune responses against HIV" pps

Ngày tải lên : 11/08/2014, 08:21

... Directed antigen delivery as a vaccine strategy for an intracellular bacterial pathogen Proc Natl Acad Sci USA 2006, 103:5102-5107 10 Roberts DM, Nanda A, Havenga MJ, Abbink P, Lynch DM, Ewald BA, ... immunizations Hematological values and liver chemistries were unremarkable at all time points These results demonstrated that oral inoculation of live attenuated Lmdd and i.v D-ala administration was ... in parentheses for each group All Lmdd-gag vaccinations were preceded by oral administration of saturated sodium bicarbonate D-ala (640 mg/kg) was co-administered intravenously before and after...

7
393
0