you can use a two dimensional array
macromedia flash mx advanced for windows and macintosh
... Pearson Education Macromedia is a registered trademark, and Macromedia Flash and Flash are trademarks of Macromedia, Inc Throughout this book trademarked names are used Rather than put a trademark symbol ... promote theatrical releases with Flash animations; and online gaming and educational sites provide rich user experiences with Flash interactivity As a vector-based animation and authoring application, ... is a technique for interpolating amorphous changes that can t be accomplished with instance transformations such as rotation, scale, and skew Fill, outline, gradient, and alpha are all shape attributes...
- 819
- 4,244
- 0
Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf
... d(5¢-AACAACGCAGCTGGGCTCTG GAACCAT), ECF -A1 41Q d(5¢-TCAACCTCTAACCAG GCTACTCCGCTG) ECM-G77Q d(5¢-AACAACGCTGG CCAGCACGCTAACCAC) and ECM-Q14 6A d(5¢-TCT ACTGCTAACGCGGATTCTCCGCTG) following the manufacturer’s ... Monod, Paris, France) as template DNA MnSOD was cloned using the primers ECM-5¢ d(5¢-AGCTATACCCTGCCATCCCTG) and ECM-3¢ d(5¢-TTATTTTTTCGCCGCAAAACGTG) and E coli genomic DNA as template PCR was carried ... simultaneously after inoculation of media with cultures grown to exponential phase in the absence of paraquat and IPTG (Materials and methods [24]) The final concentration of paraquat and IPTG used...
- 12
- 740
- 0
Báo cáo Y học: The N-terminus of m5C-DNA methyltransferase Msp I is involved in its topoisomerase activity docx
... from Stratagene The sequence of the oligonucleotides for the mutations at the underlined positions were: 5¢-ACATGGC AACAGGCGGAATCAGGTAAA-3¢ (W3 4A) and 5¢-AT ATTCTAGAAAGCTAACCAGAATCAA-3¢ (Y7 4A) The ... of truncated MspI (deletion of 34 N-terminal amino acids; del34aa) was made using the following set of primers: 5¢-CATATGgaatcaggtaaaaca-3¢ and 5¢-tgttttacctgattccCATATG-3¢ (forward and reverse ... both are human parasites Nocardia aerocolonigenes (the host of NaeI) and Moraxella (host of M.MspI) are also capable of being human parasites Two prototype bacterial m5C-MTases, M.HhaI [32] and...
- 7
- 515
- 0
Báo cáo khoa học: The transmembrane domain of subunitbof theEscherichia coli F1FOATP synthase is sufficient for H + -translocating activity together with subunitsaandc doc
... stoichiometric amounts were calculated based on the amino acid analysis performed during the synthesis of b1)34 and calibrated with the FO sample assuming a stoichiometry of ab2c10 Dialysis was carried ... subunits a, b and c [18] Whereas significant initial rates of H+ translocation could already be observed with a stoichiometric ratio of intact subunit b and ac subcomplex, a 6.6-fold molar excess ... revealed that an approximately 6-fold molar excess of b1)34 was necessary to obtain saturated H+ translocation activities, whereas the use of higher molar ratios had no further stimulating effect...
- 7
- 233
- 0
Báo cáo toán học: "The Quantum Double of a Dual Andruskiewitsch-Schneider Algebra Is a Tame Algebra" pdf
... know that the most typical examples of basic Hopf algebras of finite representation type are Taft algebras and the dual of A( n, d, μ, q), which as an associative algebra is generated by two elements ... generally tame Hopf algebras, we need more examples of tame Hopf algebras The Andruskiewitsch-Schneider algebra is a kind of generalization of generalized Taft algebra and of course Taft algebra Therefore, ... Therefore, it is natural to ask the following question: whether is the quantum double of dual AndruskiewitschSchneider algebra a tame algebra? In this paper, we give an a rmative answer As a consequence,...
- 19
- 386
- 0
Báo cáo sinh học: "The genetic control of ovariole in Sitophilus oryzae L is temperature sensitive" pptx
... 1970; Ganesalingam, 1974) At the anterior tip of each ovariole, a bacteriome containing intracellular bacteria is formed (Mansour, 1930; Nardon, 1971) This apical bacteriome disappears in the absence ... Temperature-sensitive gaster IV A mutation affecting Nat Acad Sci USA 67, 738-745 eye facet mutations in arrangement in a Drosophila melanopolarized manner Proc Ganesalingam VK (1974) Morphological ... type at 29°C and mutant type at 21°C, Foster and Suzuki, 1970); and in a homeotic mutation affecting imaginal discs, giving normal arista segment of the antennal complex at 29°C and a tarsus at...
- 18
- 273
- 0
Báo cáo y học: "Neurophysiological study to assess the severity of each site through the motor neuron fiber in entrapment neuropathy" potx
... patients were bilaterally affected Fifty four patients had CTS hands on the unilateral side and 54 contra-lateral hands were asymptomatic The diagnosis of CTS in all patients was reconfirmed at ... patients for anatomical and pathological reasons [13] Kwon et al revealed that C6, C7 radiculopathy had no significant influence on sensory responses while C8 radiculopathy had no significant influence ... values for each group are presented as means + standard deviation (SD) using statistical software (Statview 4.5J, SAS, Cary, NC) The significance of differences between the values was analyzed using...
- 7
- 298
- 0
Báo cáo y học: "Effects on respiratory function of the head-down position and the complete covering of the face by drapes during insertion of the monitoring catheters in the cardiosurgical patien" pot
... times and A similar comparison between times and showed a small nonsignificant increase in PaO2 and SaO2 in groups A1 and B1, and a significant increase (P < 0.05) in PaO2 and SaO2 in group C After ... nonsignificant change in PaO2 and SaO2 at times 3, and at all times In patients in groups A2 and B2, SaO2 was never below 93% during the two manoeuvres [5] PaCO2 remained stable, without significant ... considered statistically significant In all patients, LVEF was assessed by cardiac angiography Results The arterial blood samples to determine oxygen (PaO2) and carbon dioxide (PaCO2) tension and oxygen...
- 5
- 373
- 0
Báo cáo y học: "The acute effects of body position strategies and respiratory therapy in paralyzed patients with acute lung injury" doc
... data were collected and analyzed with commercially available data management and statistical software All data are shown as means ± SD Data were analyzed with analysis of variance for repeated ... averaged on a minute-to-minute basis and saved to a personal computer for later analysis Mixed expired CO2 concentration (PeCO2) was also measured and used along with the partial pressure of arterial ... triplicate At the 3-h time point, arterial and pulmonary artery blood was drawn for measurements of blood gases, pH, and oxygen saturation Samples were drawn, iced, and analyzed within by using standard...
- 7
- 320
- 0
Mark the letter a, b, c, or d on your answer sheet to indicate the word that differs from the rest in the position of the main stress in each of the following questions
... the area without permission A You can enter the area if you ask for permission B You can t enter the area under any circumstances C You can t enter the area without allowance D You are not allowed ... his mistakes at C his mistakes laughing at D his mistakes at laughing Question 47: I can t go with you today; I have…………… things to A a great deal B many a great C great many D a great many Question ... movement of American Indians across North America C Ceremonies and rituals of American Indians D The way of life of American Indian tribes in early North America Question 72 According to the passage,...
- 13
- 3,561
- 0
Mark the letter a b c or d on your answer sheet to indicate the word that differs from the rest in the position of the main stress in each of the following questions
... office as I can get there in five minutes A comfortable B near C available D convenient Question 30 : The boy has chosen to MBA programme in Australia A the B Þ C an D a Mark the letter A B ... A Because of the bad weather, our excursion to London was put off later B Our plans for an excursion to London have fallen through because the weather was so bad C The bad weather was the reason ... that can hold ideas and images for years and years Information can be added to your long-term memory when you actively try to put it there through memorization or when an idea or image enters your...
- 15
- 4,213
- 0
Báo cáo y học: "The evolving story of medical emergency teams in quality improvement"
... 1:296-305 Braithwaite RS, DeVita MA, Mahidhara R, Simmons RL, Stuart S, Foraida M: Use of medical emergency team (MET) responses to detect medical errors Qual Saf Health Care 2004, 13:255259 Kaplan LJ, ... Localio AR, Weaver SL, Landis JR, Lawthers AG, Brenhan TA, Hebert L, Sharp TJ: Identifying adverse events caused by medical care: degree of physician agreement in a retrospective chart review Ann ... Critical Care Vol 13 No Amaral and Shojania meeting to review each case in order to identify clinical deteriorations that had resulted primarily from problems in antecedent care Two previous...
- 2
- 427
- 0
Báo cáo y học: "The Versatile Use of Temporoparietal Fascial Flap"
... island, deep temporal fascia, and also segmental parietal bone can be raised with this flap The TPFF and its variants can be used as free or pedicled, one or two- stage (prefabricated and prelaminated) ... primary conchal cartilage grafts, a free temporoparietal fascial flap, and a full-thickness supraclavicular skin graft.19 The temporoparietal fascial flap has been commonly used for coverage ... 2009; 123(2): 556-61 Navarro-Ceballos R, Bastarrachea RA Clinical applications of temporoparietal hair-bearing flaps for male pattern baldness and mustache formation Aesthetic Plast Surg 1991; 15(4):343-8...
- 7
- 727
- 0
Báo cáo y học: "Anticancer Activity of the PR Domain of Tumor Suppressor RIZ1"
... under a microscope At least 100 cells were counted for each treatment Statistical analysis was performed using GraphPad InStat (GraphPad Software, San Diego, California, USA) Anticancer activity ... folds at stage III in prostate cancer (Fig 1) Because cancer undergoes metastasis and spreads to other organs at late stages, we speculated that RIZ1 might play an important role in tumor metastasis, ... in normal and cancer patients for each cancer type was performed with GraphPad Prism 4.0 (GraphPad Software, San Diego, California, USA) 162 Cell culture of HuH7 cell line Human hepatoma HuH7...
- 7
- 467
- 0
Báo cáo y học: "Effects of Losartan on expression of connexins at the early stage of atherosclerosis in rabbits"
... imaging software Statistical Analysis Data are presented as mean ± SD Data of multiple groups were analyzed by one-way analysis of variance Means between two groups were compared with a two- tailed ... dehydrogenase (GAPDH): forward: 5’-GCGCCTGGTC ACCAGGGCTGCTT-3’, reverse: 5’-TGCCGAAGTG GTCGTGGATGACCT-3’; b) Cx40-1: forward: 5’-ATGCACACTGTGCGCATGCAGGA-3’, reverse: 5’-CAGGTGGTAGAGTTCAGCCAG-3’; ... Hematoxylin/eosin staining of the iliac arteries in the normal group (panel A) , high fat diet group (panel B), and high fat diet plus losartan group (panel C) In panel A, the elastic lamina was...
- 8
- 467
- 0
Báo cáo y học: "The Natural History of Hepatitis C Virus (HCV) Infection"
... infection among African Americans (86%), compared to Caucasians (68%) (p=0.02) In addition, African American had a lower rate of sustained viral response (SVR) to interferon and ribavirin treatment ... among different racial and ethnic groups with HCV infection For unclear reasons, African Americans appear to have a higher rate of chronic HCV infection than Caucasians and Hispanic whites In prospective ... National Health and Nutrition Examination Survey (NHANES), a national survey of a representative sample of non-institutionalized civilian Americans conducted between 1988 and 1994 In the NHANES...
- 6
- 530
- 0
Báo cáo y học: "Foundation for the Community Control of Hereditary Diseases, Budapest, Hungary"
... selective abortion, i.e termination of pregnancy after the prenatal diagnosis of severe fetal defects was also named as secondary prevention Recently the WHO and other international bodies have excluded ... to achieve a complete recovery in 33.5% of cases with congenital abnormalities Thus, there are two main conclusions: at present the major part of congenital abnormalities (85.3%) are preventable; ... of primary prevention Tsitologija i Genetika 2002; 36: 56-71 Figure Figure Classification of Congenital Anomalies Congenital Anomalies (Birth Defects) Congenital abnormality (CA) (e.g neural-tube...
- 2
- 626
- 0
Báo cáo y học: "Gene Therapy: The Potential Applicability of Gene Transfer Technology to the Human Germline"
... promoters and enhancers (etc) can be included in MACs Preliminary research indicates that MACs can be used, via pronuclear microinjection, to create transgenic animals in which the MACs are maintained ... does appear to be somewhat better than that of pronuclear microinjection The available experimental data on standard human ICSI (i.e not involving genetic modification) indicate that: (a) the majority ... Hirabayashi M, Takahashi R, Ito K, et al A comparative study on the integration of exogenous DNA into mouse, rat, rabbit, and pig genomes Exp Anim 2001; 50(2):125-131 Bishop JO Transgenic Mammals...
- 16
- 506
- 1
Báo cáo y học: "The primary prevention of birth defects: Multivitamins or folic acid"
... (0.01-0.47) * Anencephaly 2, Anencephaly +spina bifida (lumbal, thoracolumbal) 2, Spina bifida 2, thoracolumbal 1, lumbosacral ** Anencephaly ***Anencephaly 1, Spina bifida 8, thoracolumbal 1, lumbal 4, ... and other candidate CAs [14] On the other hand the large population-based dataset of the Hungarian Case-Control Surveillance of Congenital Abnormalities (HCCSCA) [17] can provide a chance for ... acid As far as I know the Hungarian data sets are unique to answer these questions On the one hand now the results of the two Hungarian intervention trials are available and their pooled data...
- 12
- 487
- 0
Báo cáo y học: "Study of the early steps of the Hepatitis B Virus life cycle"
... Hepatitis B Foundation of America; an Appropriation from the Commonwealth of Pennsylvania USA, Nucleonic Inc (PA USA) Drs Satishchandran C and Cathy Pachuk (Nucleonics Inc, PA, USA), Baohua Gao ... hepatitis B virus envelope are virus neutralizing Vaccine 1986 4(1): 35-7 34 Machida A, Kishimoto S, Ohnuma H, Miyamoto H, Baba K, Oda K, Nakamura T, Miyakawa Y, Mayumi M A hepatitis B surface antigen ... C, Ruvoletto MG, De Falco S, Marino M, Valente M, Nitti D, Gatta A, Fassina G Overexpression of squamous cell carcinoma antigen variants in hepatocellular carcinoma Br J Cancer 2004 90 (4): 833-837...
- 13
- 654
- 1
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25