... (%Æmin )1) Fext AÆT AÆC A G AÆA 0.037 86 42 68 29.9 13 .6 10 .2 11 .4 1/ 5 ,10 0 1/ 3,400 1/ 4,800 higher than that of HIV- 1 RT (46%) However, by calculating the level of extension after correcting for ... the text Pair or mispairs formed Km (lM) Vmax (%Æmin )1) Fins AÆT AÆC A G AÆA 0.004 28 45 55 25 15 .1 4.5 1.1 1/ 11 600 1/ 62 500 1/ 300 000 [16 ,19 – 21] The assays were performed with templateprimers ... explaining the extensive genetic heterogeneity of both HIV- 1 and HIV- 2, which affects viral pathogenesis, the rapid emergence of drug-resistant variants and, hence, the progression of AIDS [2 ,10 ,11 , 31] ...
... 256, 11 137 11 144 11 Pieulle L, Guigliarelli B, Asso M, Dole F, Bernadac A & Hatchikian EC (19 95) Isolation and characterization of the pyruvate-ferredoxin oxidoreductase from the sulfate-reducing ... nonsaturating conditions.) Although the [3Fe-4S ]1+ signal in Fig 3A disappeared at temperatures exceeding 30 °K, the g = 2.0040 signal remained even at 70 °K (data not shown), indicating that this signal ... acetylCoA and CO2, by the coupled assay with OGOR and LDH (Fig 1) Although carboxylation activity is generally determined by monitoring the incorporation of 14 CO2 to form [14 C] pyruvate, OGOR catalyzes...
... (08/00 21. 1/20 01) H.O was supported by a Fellowship from Fundacao para a Ciencia e a Tecnologia (SFRH/BD/ ¸ ˜ ˆ 14 77/2000) 10 11 12 13 14 15 16 17 18 19 20 REFERENCES Sillero, M.A .G. , Socorro, S., Baptista, ... mM EDTA, 10 0 lgÆmL )1 acetylated BSA, 10 % glycerol, 0.5 mM MgCl2, 0.2 mM ATP and 0.44 units of the enzyme (part A) Reaction mixtures supplemented with 0.04 mM Gp 2G, 0 .1 mM Gp 3G or Gp 4G are shown ... According to our results, the amount of Ó FEBS 2002 Poly(A) polymerase activation by dinucleotides (Eur J Biochem 269) 5327 Fig Effect of diguanosine polyphosphates (Gp 2G, Gp 3G, Gp 4G, Gp 5G) on the...
... CDP-DAG Reverse reaction Lower phase Upper phase Exchange reaction – CMP + lM CMP –PIS 2 019 ± 71 )10 8 ± 10 3 ± 13 )1 125 ± 11 09 ± 13 8 0 exogenous PtdIns De novo synthesis was measured in the incubation ... the C16:0/C17c + C18 :1/ C17c and C16:0/C19c peaks are characteristic of E coli (A.-M Justin, unpublished data) whereas the C16:0/C18:2 and C18:0/C18:2 PtdIns are characteristic of soybean [14 ] ... (Fig 2A), with values close to 0.8 nmol PtdInsÆmg )1 min )1 at mM EDTA, increasing to nmol PtdInsÆmg )1 min )1 between 2.5 and mM EDTA and a drop to at 10 mM Abolition of all exchange activity at 10 ...
... (2006) 415 4– 415 9 ª 2006 The Authors Journal compilation ª 2006 FEBS 15 K Ozawa et al 10 11 12 13 14 15 16 17 Nureki O & Yokoyama S (20 01) Selenomethionine incorporation into a protein by cell-free ... 272, 316 2– 317 1 Wu PSC, Ozawa K, Jergic S, Su XC, Dixon NE & Otting G (2006) Amino-acid type identification in 15 N-HSQC spectra by combinatorial selective 15 N-labelling J Biomol NMR 34, 13 – 21 Ozawa ... S30 cell extract [7 ,19 ] or by replacing the originally recommended glutamate buffer [1] by acetate [7 ,18 ] Different amino acids are susceptible to [15 N]-scrambling in the wheat germ system than...
... the pET24b vector to generate pET24b(relA) The correct sequence of relA was confirmed by sequencing using the primers 5¢-AGCAATACGCTCCGCCAG-3¢, 5¢-TGGCGGATGCCAACGTAG-3¢, 5¢-CTCGACCGCGA ACACTAC-3¢, ... MA, USA) Cloning of the E coli relA gene The relA gene was amplified by PCR from E coli MRE 600 genomic DNA with primers 5¢-CGGGAATTCCATATGGT TGCGGTAAGAAT-3¢ and 5¢-CCCGCTCGAGACTCCCG FEBS Journal ... primers were used: 5¢-CCGAACTGTCT CACGAC-3¢ (906, 16 S rRNA), 5¢-TGTTATCCCCGGAG TAC-3¢ (2437, 23S rRNA), 5¢-GCATTTCACCGCTACAC-3¢ (683, 16 S rRNA) and 5¢-TCCGTCTTGCCGCGGGT-3¢ (2042, 23S rRNA) The...
... MD1Pa, Glc1P unit of MD1P; MD1Pb, Glc unit neighbouring the Glc1P of MD1P; MD, linear maltodextrins; MDt, the terminal Glc unit of MD; MDint, internal Glc units of MD and MD1P X, unknown Glc1P ... Sugar Succinate Acetate Sugar Succinate Acetate No Glc CB M2 M3 M4 M6 M2M3 M2M4 M3M4 M3M6 0.0 12 .6 13 .6 0.0 0.9 0.5 0.5 1. 4 1. 5 1. 0 1. 3 0.0 6.4 6.5 0.0 1. 5 1. 4 2 .1 2.9 3.0 2 .1 2.0 M2 to CB M3 to CB ... Futile cycling of glycogen in Fibrobacter succinogenes as shown by in situ 1H-NMR and 13 C-NMR investigation Eur J Biochem 207, 15 5 16 2 Aghajanian SA, Martin SR & Engel PC (19 95) Ureainduced inactivation...
... (mM) 1. 0 2.0 Peak number Average % SEM Average % SEM Average % SEM A B C D E F G H I 4.52 6.52 9.59 14 . 61 20.59 18 .78 9.56 7. 91 7.92 0.72 0.43 0. 51 0.20 1. 50 1. 38 0.86 0.28 0.97 3.36 4.85 7.74 11 .27 ... 7.74 11 .27 20.02 26.37 12 .44 7.64 6.33 0.22 0.83 0.98 0.28 0.98 0.99 0 .18 0.50 0. 41 3 .12 3. 41 6.04 10 .03 18 . 91 29.30 14 .39 8.06 6.65 1. 48 0.52 0.67 0.84 1. 45 1. 09 0 .14 0.88 1. 00 added in the cell-free ... after digestion with lysozyme and bovine testicular hyaluronidase The primer set used in the PCR had the following sequence: forward, 5¢-ACTGTTGTGGCCTTTAGTA-3¢ and reverse, 5¢-AAGGGCTGTAGGACAAACAA-3¢...
... 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 intramitochondrial cholesterol translocator J Biol Chem 262, 918 1– 918 8 Miller, W.L (19 88) Gene conversions, deletions and polymorphisms in congenital ... although the role of CTE-I in steroidogenesis is currently not known The high degree of sequence similarity between the CTE-I and MTE-I genes suggests that they diverged relatively recently by gene ... adding 0 .1 mM isopropyl thio-b-D-galactoside (IPTG) After recovery by centrifugation, cells were resuspended and lysed by sonication (4 · 15 s) in NaCl/Pi, containing 0 .1% 2-mercaptoethanol, mgÆmL)1...
... light scattering The sequence of the 12 1-mer ssDNA substrate PUC+, used in this study was: 5¢—TTTCCCAGTCACGA CGTTGTAAAACGACGGCCAGTGCCAAGCTTGCAT GCCTGCAGGTCGACTCTAGAGGATCCCCGGGTAC CGAGCTCGAATTCGTAATCATGGTCATAGCTGTTT ... analysed by native gel electrophoresis (Fig 1A) and centrifugation assays (Fig 1B) hRad 51 migrated as a highly aggregated form (several hundred kDa complexes) that barely entered into the gel Only ... al DNA-induced disassembly of higher oligomeric forms of hRad52 Protein aggregation/disaggregation changes vs ionic effects A similar effect of disaggregation by ssDNA was also observed with...