worksheet sparklines are not objects — a sparkline is actually a tiny chart in the background of a cell because a sparkline is a tiny chart embedded in a cell you can enter text in a cell and use a sparkline as its background
Báo cáo y học: " A Leu to Ile but not Leu to Val change at HIV-1 reverse transcriptase codon 74 in the background of K65R mutation leads to an increased processivity of K65R+L74I enzyme and a replication competent virus" pptx
... DR and CC were involved in analysis of data and suggesting experimental design for the study All authors have read and approved the final manuscript Authors’ information PLS is an Assistant Professor ... Atlanta VA Medical Center DR is involved in HIV clinical research since past 20 years CC is Professor of Medicine at Harvard Medical School and has published several key papers in the area of ... this manuscript HBC is a post doctoral associate and is working in the area of HIV replication fitness since Jan 2008 VN is currently a resident in Family medicine and has worked in the laboratory...
- 12
- 369
- 0
Báo cáo y học: " The use of partial exchange blood transfusion and anaesthesia in the management of sickle cell disease in a perioperative setting: two case reports" pot
... his vital signs and maintaining them within tight ranges Anaesthesia from the beginning up to the end of surgery lasted 80 minutes Postoperative care, including fluid management and weaning off ... this article as: Jaeckel et al.: The use of partial exchange blood transfusion and anaesthesia in the management of sickle cell disease in a perioperative setting: two case reports Journal of ... during anaesthesia and the perioperative period [5,6] The clinical symptoms of SCD, which start in early childhood, are splenomegaly, haemolytic anaemia and relapsing pain A diagnosis of SCD can...
- 6
- 438
- 0
Báo cáo y học: " Membrane diffusion- and capillary blood volume measurements are not useful as screening tools for pulmonary arterial hypertension in systemic sclerosis: a case control study" pptx
... occurs in PAH results in a decrease in capillary flow and thus a decrease in Vc This will result in a reduction in surface area available for gas exchange, and therefore in a decrease of Dm [25] ... Secondly, parenchymal and vascular destruction in areas of Dm and Vc in SScPAH+ compared with SScPAHDm% in SScPAH+ was significantly lower as compared with SScPAH- This difference could not be ascribed ... et al [23] These scores were also added and are reported as the total fibrosis score [24] Statistical analysis SPSS 12.0 software package (Chicago, IL) was used for statistical analyses, and...
- 8
- 264
- 0
Tài liệu Báo cáo Y học: The b-1,4-endogalactanase A gene from Aspergillus niger is specifically induced on arabinose and galacturonic acid and plays an important role in the degradation of pectic hairy regions pdf
... Onion arabinogalactan consists of 99% D-galactose and 0.3% L-arabinose and is predominantly linear Potato arabinogalactan consists of 86% D-galactose and 6.6% L-arabinose, while soy arabinogalactan ... amount of a- L-1,3-arabinofuranosidase was responsible for the disappearance of Fig HPAEC analysis of the hydrolysis of arabinogalactans by GALA Three different arabinogalactans were used: potato ... characterization of GALA Hydrolysis of arabinogalactans To obtain an A niger transformant that produces increased levels of b-1,4-endogalactanase, a construct was made in which galA was fused to the...
- 9
- 669
- 0
Đề tài " Axiom A maps are dense in the space of unimodal maps in the Ck topology " doc
... periodic attractor If this attractor is hyperbolic, we are done because then there are no neutral periodic orbits and the map is an Axiom A map The other case is that the attractor is a neutral periodic ... n(x)} are small and they are disjoint; so we can apply Lemma 3.2) Near the critical point the map f is almost quadratic (if T0 is small enough) and because of the choice of T0 the interval f (T1 ... Polynomial-like maps The notion of polynomial-like maps was introduced by A Douady and J H Hubbard and was generalized several times after that The main advantage of using this notion is that one can...
- 44
- 412
- 0
BRANDS ARE BUILT IN THE CONSCIOUSNESS OF THE RECEIVER, NOT BY THE COMPANY potx
... both in individual purchasing decisions and through their basic power over increasingly valuable assets in the form of brands A brand doesn’t have a personality,” says American marketing guru Al ... build and maintain strong brands In the end, almost all brand work is about increasing competitiveness and profitability in a company.” “Today we have a global brand platform that includes a number ... than out of the company If so, this may be because operations are going well, but also because investments are put on hold Cash flow is often used to assess the value of an investment, such as a...
- 36
- 485
- 0
The History of Banks: To Which Is Added, a Demonstration of the Advantages and Necessity of Free Competi- tion In the Business of Banking. Richard Hildreth doc
... Bank was saved, as always happens in such cases, by the ruin of individuals The sudden contraction of its loans increased the general pressure and alarm; and the list of private failures was almost ... now, was divided into a bank party and an anti-bank party, and the struggle was severe In 1785, the anti-bank party prevailed in the legislature, and the bank charter was repealed; The History of ... over the kingdom; and as the capital and credit of the Bank increased, they continued to gain an increasing circulation Previous to the year 1796, that circulation was generally about equal in amount...
- 78
- 775
- 0
Báo cáo khoa học: A new pathway encompassing calpain 3 and its newly identified substrate cardiac ankyrin repeat protein is involved in the regulation of the nuclear factor-jB pathway in skeletal muscle pdf
... CGCCATGGCAATGATGGTACTGAAAGTAGAGG CGGCCCGGGAACTGATTAAGAGTCTGTCG GAGCCATGGAACAACGGAAAAGCGAGAAAC CGGCCCGGGAACTGATTAAGAGTCTGTCG CACCATGATGGTACTGAGAG GAATGTAGCTATGCGAGAGTTC CACCATGGCCGAGTTCAGAAATGGAGAAG ... CACCATGGCCGAGTTCAGAAATGGAGAAG GAATGTAGCTATGCGAGAGTTC CACCATGCTGAAGACACTTCCGGCCAACAG GAATGTAGCTATGCGAGAGTTC CACCATGCTGAAAGCTGCGCTGGAGAAC GAATGTAGCTATGCGAGAGTTC CACCATGACCAAAGTTCCAGTTGTGAAGG GAATGTAGCTATGCGAGAGTTC CACCATGATGGTACTGAGAG ... binding domain (pAS-C3) was used as a bait and a construct encoding CARP fused with the activation domain (pGAD-CARP) was used as a prey The yeasts resulting from the mating of clones transformed...
- 16
- 462
- 0
Báo cáo khoa học: Inactive forms of the catalytic subunit of protein kinase A are expressed in the brain of higher primates potx
... TGCCATGAAGATCTTAGA TGAGCAGTACTACGCCATGA GTAGCCCTGCTGGTCAATGA TTCCGTAGAAGGTCCTTGAG (VII) TTCCGTAGAAGGTCCTTGAG (VII) CCTAATGCCCACCAATCCA (VI) TTCCGTAGAAGGTCCTTGAG (VII) TTCCGTAGAAGGTCCTTGAG (VII) CTAATCTATGAAATGGCAG ... cerebral cortex and amygdala was purchased from BioChain Institute (Hayward, CA, USA) as PCR Ready First strand cDNA Total RNA from human adult brain (1.1 lgÆlL)1) was purchased from Stratagene (La ... Supplementary material The following supplementary material is available online: Fig S1 Comparison of human and Rhesus monkey PKA Cb amino acid sequence This material is available as part of the online...
- 13
- 344
- 0
Báo cáo sinh học: " Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" pot
... transmission of a recombinant virus, in a hypothetical in vivo situation, from one rodent to another If transmission is performed in a samplinglike fashion – and this seems to be the case for hantaviruses ... "immature" status When, under similar experimental settings, TUL02 has been passaging in the presence of another isolate, TULV/Lodz, none of the two viruses was able to establish a dominance during ten ... recombination awaits further investigation Conclusion The data presented in this paper show that the recTULV presents no real match to the original cell adapted variant and that the lower fitness of the...
- 5
- 483
- 0
báo cáo hóa học:" Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" ppt
... transmission of a recombinant virus, in a hypothetical in vivo situation, from one rodent to another If transmission is performed in a samplinglike fashion – and this seems to be the case for hantaviruses ... "immature" status When, under similar experimental settings, TUL02 has been passaging in the presence of another isolate, TULV/Lodz, none of the two viruses was able to establish a dominance during ten ... recombination awaits further investigation Conclusion The data presented in this paper show that the recTULV presents no real match to the original cell adapted variant and that the lower fitness of the...
- 5
- 430
- 0
báo cáo hóa học:" HIV prevention is not enough: child survival in the context of prevention of mother to child HIV transmission" potx
... breastfeeding is best for all infants, regardless of their HIV status, and is associated with decreased infant mortality [34] Another advantage of lactation counselling is that simple and consistent ... but because in the delicate risk-benefit balance, mortality caused by abstinence from breastfeeding or shortening the duration of breast- Figure infants Balancing adverse outcomes in breastfed and ... there are many challenges ahead HIV treatment and PMTCT programmes should not be implemented as distinct and competing programmes, but can and should work hand in hand so that maternal health is addressed...
- 10
- 569
- 0
Báo cáo hóa học: " Enabling direct connectivity between heterogeneous objects in the internet of things through a network-service-oriented architecture" docx
... networked objects are mobile • The context associated with information is also increasingly important Future devices require mechanisms to easily associate metadata with content, such as the originating ... entities that implement a single software function These software services are dynamically combined to form ad hoc applications In regards to the internet of things, SOAs have two main disadvantages ... delays, the current implementation only delays the parameters in the waiting space of the initial node: packets are not further delayed in intermediate nodes Since the aggregation is part of the...
- 14
- 660
- 3
Everyone Is a Customer - A Proven Method for Measuring the Value of Every Relationship in the Era of Collaborative Business pot
... such as Pakistan that previously supported the Taliban Fearing instability, Pakistan offered information about, and access to, the Taliban and Afghanistan to the United States In return, the United ... that take place within the collaboration 16 ❚ Because collaborative business is relationship based as opposed to transaction based, it is not easily quantified and controlled This lack of analytical ... companies that attract others and are skilled at managing the relationships.” So how you it? How you look at the myriad relationships that your company has, or rather that you and your colleagues...
- 236
- 507
- 0
Everyone Is a Customer - A Proven Method for Measuring the Value of Every Relationship in the Era of Collaborative Business pdf
... such as Pakistan that previously supported the Taliban Fearing instability, Pakistan offered information about, and access to, the Taliban and Afghanistan to the United States In return, the United ... that take place within the collaboration 16 ❚ Because collaborative business is relationship based as opposed to transaction based, it is not easily quantified and controlled This lack of analytical ... companies that attract others and are skilled at managing the relationships.” So how you it? How you look at the myriad relationships that your company has, or rather that you and your colleagues...
- 236
- 617
- 0
Báo cáo y học: "Cartilage degradation is fully reversible in the presence of aggrecanase but not matrix metalloproteinase activity" pdf
... assays for measuring sulphated glycosaminoglycans (S-GAGs) are available, these assays not distinguish between synthesis and degradation of the proteoglycans [19] Furthermore, they not distinguish ... that OSM + TNF-stimulated degradation, mediated by aggrecanases and measured using the 374ARGSV-G2 assay, was high at day 7, intermediate at day 10, and almost absent at day 17 (Figure 3a) This ... showed that MMP-mediated aggrecan was undetectable at days and 10 and high at day 17 (Figure 3b) The high aggrecanase activity at the early stages of culture may mask the MMP-mediated aggrecan epitope...
- 12
- 485
- 0
everyone is a customer a proven method for measuring the value of every relationship in the era of collaborati phần 2 ppsx
... plummeting valuations, and soaring layoffs Others have a sense of the association and are trying to see their way clear Not all of the economic malaise of the years 2000 to 2002 is due to these ... have always iterated as each nation learns more about how the other can help it achieve its goals In essence, what this Collaborative Community of nations is doing is trading cash and non-cash ... that take place within the collaboration 16 ❚ Because collaborative business is relationship based as opposed to transaction based, it is not easily quantified and controlled This lack of analytical...
- 24
- 323
- 0
everyone is a customer a proven method for measuring the value of every relationship in the era of collaborati phần 3 docx
... desolate area The store, as a cornerstone of the community, has really brought the whole area to life So what is his interest in having us there? Before our machine was there, there was a gumball ... with a company that performs much of the software programming for the cable industry And they are trying to use their software to move into managing media content on overhead advertising screens—like ... that interact with each other in a mutually beneficial and personal manner As we’ve said, traditional industry structures are vestiges of another era that are in the process of dying 2 ❘ Collaborative...
- 24
- 363
- 0
everyone is a customer a proven method for measuring the value of every relationship in the era of collaborati phần 4 ppt
... Chris and Joe understand they can t win customers by offering the lowest price, nor can they afford the kind of marketing and advertising that would make their name as well known as that of many ... collaborative initiatives will increasingly find themselves isolated and unable to satisfy their customers’ personal needs and wants So rather than continuing with the status quo of legacy thinking and ... relationship is exactly the same We also understand that many businesspeople appreciate the importance of relationships and the use of non-cash currencies, but as collaboration becomes increasingly...
- 24
- 301
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008