working with john lane a person centred approach to supporting the person with dementia and their carers
Báo cáo khoa học: "Veterinary decision making in relation to metritis - a qualitative approach to understand the background for variation and bias in veterinary medical records"
Ngày tải lên :
25/10/2012, 10:45
... scoring a cow and initiating a metritis treatment), would you please elaborate on that specific situation?' Data Analysis The qualitative analysis is based on a phenomenographic approach; that is a ... scores as a 'diagnostic tool' related to each individual treatment decision rather than being part of a collaborative data collection For example, they could add rectal temperature and other parameters ... farm and population level The dotted arrow between population level and farm level indicate that few veterinarians use data analysis in their daily practice and advice tions and human decision making,...
- 10
- 587
- 0
Báo cáo khoa học: "A Unification-based Approach to Morpho-syntactic Parsing of Agglutinative and Other (Highly) Inflectional Languages" doc
Ngày tải lên :
23/03/2014, 19:20
... simplified, and does not show an important aspect of the parser, namely, it retains the unification-based approach introduced in the morphological analyzer This means that all atomic elements in a phrase ... allomorph-based variant of Example is shown by Example There is an equivalence relation on the set of affix arrays l0 Nom means nominal, N, Adj and Adv as usual Some remarks to the sample words: ... have to be included in a single database Thus stemming is a combination of the morphological analysis and a post-processing phase where the actual stems (lexical forms) are extracted from the analysis...
- 8
- 404
- 0
Báo cáo khoa học: "A Unification-based Approach to Morpho-syntactic Parsing of Agglutinative and Other (Highly) Inflectional Languages" ppt
Ngày tải lên :
23/03/2014, 19:20
... simplified, and does not show an important aspect of the parser, namely, it retains the unification-based approach introduced in the morphological analyzer This means that all atomic elements in a phrase ... allomorph-based variant of Example is shown by Example There is an equivalence relation on the set of affix arrays l0 Nom means nominal, N, Adj and Adv as usual Some remarks to the sample words: ... have to be included in a single database Thus stemming is a combination of the morphological analysis and a post-processing phase where the actual stems (lexical forms) are extracted from the analysis...
- 8
- 412
- 0
báo cáo khoa học: " A modified TILLING approach to detect induced mutations in tetraploid and hexaploid wheat" pptx
Ngày tải lên :
12/08/2014, 03:21
... ATTTACCCGCAGGTAAATTTAAAGCTTCAGTATTATGAAGCGCCTCCACTAGTCTACTTGCATATCTTACAAGAAAATTTATAATTCCTGTTTTCGCCTCTCTTTTTTCCA ATTTACCCGCAGGTAAATTTAAAGCTTTACTATGA -AACGCCTCCACTAGTCTAATTGCATATCTTATAAGAAAATTTATAATTCCTGTTTTCCCCTCTCTTTTTTCCA ATTTACCCGCAGGTAAATTTAAAGCTTTATTATTATGAAACGCCTCCACTAGTCTAATTGCATATCTTATAAGAAAATTTATAATTCCTGTTTTCCCCTCTCTTTTTTCCA ... ATTTACCCGCAGGTAAATTTAAAGCTTTATTATTATGAAACGCCTCCACTAGTCTAATTGCATATCTTATAAGAAAATTTATAATTCCTGTTTTCCCCTCTCTTTTTTCCA B A genome B genome D genome CCTCGATTTTATTTTCTAATGTTATTGCAATAGCTCGGTATAATGTAACCATGTTACTAGCTTAAGATGGTTAGGGTTTCCCACTTAGGATGCATGAAATATCGCATTGGA ... CCTCGATTTTATTTTCTAATGTTATTGCAATAGCTCGGTATAATGTAACCATGTTACTAGCTTAAGATGGTTAGGGTTTCCCACTTAGGATGCATGAAATATCGCATTGGA CCTCGATTTTATTTTCTAATTTCTTCATATTGGCAAGTGCATAACTTTGCTTCCTCTCTGT -CTCGTTTTTTTG -TCTCTAAGATTTCCATTGCATTTCGAGGTAGC CCTCGATTTTATTTTCTAATGTCTTCATATTGGCAAGTGCAAAACTTTGCTTCCTCTTTGTCTGCTTGTTCTTTTGTCTTCTGTAAGATTTCCATTGCATTTGGAGGCAGT...
- 14
- 324
- 0
A systems biology approach to elucidating the frequency decoding mechanism governing differential mammalian gonadotropin subunit gene expression
Ngày tải lên :
11/09/2015, 09:11
... consequences of calcium release into the cytoplasm and the activation of PKCs is the firing of the three major MAPK cascades, culminating in the activation of extracellular-signal regulated kinase (ERK) ... is necessary for ROKβ binding Alternatively, as ROKβ and its substrates are localized to membranes and the associated contractile apparatus, it is conceivable that Gem colocalization with ROKβ ... their ability to shuttle between the nuclear and cytoplasmic compartments [141, 143] The mammalian class I HDACs (HDAC1, 2, 3, and 11) are most closely-related to RPD3 in that they 19 share a similar...
- 233
- 258
- 0
Báo cáo hóa học: " Research Article A Unified Approach to BER Analysis of Synchronous Downlink CDMA Systems with Random " doc
Ngày tải lên :
22/06/2014, 19:20
... , and m is the Nakagami-m fading i α parameter We have used the Nakagami-m fading model since it can represent a wide range of multipath channels via the m parameter For instance, the Nakagami-m ... a one -to- one mapping between the parameter m and the Rician K factor allows the Nakagami-m distribution to closely approximate Rician fading distribution [9] As the fading parameter m tends to ... Lilliefors test The Lilliefors test [20] evaluates the hypothesis that data has a normal distribution with unspecified mean and variance against the alternative data that does not have a normal distribution...
- 12
- 360
- 0
Báo cáo hóa học: " A Frequency Domain Approach to Registration of Aliased Images with Application to Super-resolution" docx
Ngày tải lên :
22/06/2014, 23:20
... shifted and rotated images of a planar scene are captured (Figures 7 (a) and 7(b)1 ) The planar scene is a resolution test chartin a plane parallel to the image plane of the camera These images are then ... vertical shifts, Δx1 and Δx2 , and a planar rotation angle φ A frequency domain approach allows us to estimate the horizontal and vertical shift and the (planar) rotation separately Assume we have ... artifacts can occur with this camera The camera was firmly fixed on a stable tripod that allows only horizontal and vertical shifts and planar rotations parallel to the image plane With this camera setup,...
- 14
- 247
- 0
Báo cáo y học: "A novel approach to measure the contribution of matrix metalloproteinase in the overall net proteolytic activity present in synovial fluids of patients with arthritis" pptx
Ngày tải lên :
09/08/2014, 08:22
... Yoshihara Y, Nakamura H, Obata K, Yamada H, Hayakawa T, Fujikawa K, Okada Y: Matrix metalloproteinases and tissue inhibitors of metalloproteinases in synovial fluids from patients with rheumatoid arthritis ... Momohara S, Kashiwazaki S, Inoue K, Saito S, Nakagawa T: Elastase from polymorphonuclear leukocyte in articular cartilage and synovial fluids of patients with rheumatoid arthritis Clin Rheumatol ... of the MMP family is the hallmark of several inflammatory disorders, including arthritis MMP-9, in particular, has been implicated in the degradation and damage of articular cartilage in RA and...
- 10
- 494
- 0
báo cáo khoa học: "Collaborative planning approach to inform the implementation of a healthcare manager intervention for hispanics with serious mental illness: a study protocol" pptx
Ngày tải lên :
10/08/2014, 11:20
... dominant language (e.g., Spanish) to reduce language barriers and drafting all patient educational materials at the appropriate reading level (e.g., fourth grade) to enhance health literacy Surface ... transcripts and develop an open coding schema based on a priori and emergent themes Each code condenses the data into analyzable units, ranging from a phrase to paragraphs They will then meet with the ... of these interviews are to identify factors that facilitate or impede the acceptability and sustainability of the intervention and identify strategies to maximize its acceptability and sustainability...
- 12
- 423
- 0
Báo cáo y học: "A genome-wide approach to identify genetic loci with a signature of natural selection in the Irish population" pps
Ngày tải lên :
14/08/2014, 17:22
... additional data are available with the online version of this paper Additional data file is a table listing the microsatellite primer sequences and annealing temperatures Additional data file is a table ... from 27% to 23% (Additional data file 2) Tryptases have been implicated as mediators in the pathogenesis of asthma and other allergic and inflammatory disorders [26] The suggestion of balancing ... fibrosis: a worldwide analysis of CFTR mutations-correlation with incidence data and application to screening Hum Mutat 2002, 19:575-606 Cavalli-Sforza L, Menozzi P Piazza A: The History and Geography...
- 9
- 456
- 0
Chapter 9: Working with Selections and Selection Layers
Ngày tải lên :
27/08/2012, 14:31
... Sure, it’s a great way to add some color to clothes and hair, but there are other ways you can use tones to your advantage: ߜ Character emotion: In many instances of manga, you can use the background ... desired value At the top of the Tones tab, you see three icons You can use these to manipulate the position of the tone on the page within its pasted area (that means any areas on the page that don’t ... in the area Alternatively, you can use any of the drawing tools (Pencil, Pen, Marker, Pattern Brush) to draw on the tone layer with either the black or transparent colors This is a great way to...
- 39
- 754
- 0
Working with Categories and Email
Ngày tải lên :
07/11/2013, 06:15
... usually matter, as long as the recipient is set to receive RTF-formatted messages After your messages are assigned categories, you can use smart grouping, search folders, and Advanced Find to ... Click the Master Category List button to add or remove categories from the master list stored in the Registry Although you can add categories from the Categories dialog, you can remove them only ... message using rich text formatting In most cases, you need to double-click on the recipient's address and choose Send Using Rich Text Format in the Internet Format dialog The actual message format...
- 3
- 256
- 0
Tài liệu 16.3. Working with Files and Directories pptx
Ngày tải lên :
14/12/2013, 12:15
... indicates where they go POWER USERS' CLINIC Your Metadata's Safe with Us Metadata means "data about data." For example, the handwritten note on a shoebox of photos is metadata for the image data ... command with a pathname To move the Tahoe1 movie file into your Documents directory and rename it LakeTahoe at the same time—type this: mv Tahoe1.mov ~/Documents/LakeTahoe.mov All the usual shortcuts ... reminding you of the photos' date, location, camera information, or even which CDs hold the digital versions This metadata lets you locate and access the actual data quickly (and also helps you...
- 8
- 446
- 0
Tài liệu Working with Wireframe and Surface Design Workbench doc
Ngày tải lên :
16/12/2013, 03:15
... YZ plane as the sketching plane Choose the Axis button from the Profile toolbar and draw a vertical axis passing though the origin Next, draw the sketch, as shown in Figure 9-51 and exit the ... angle values in the respective spinners You can also add a taper angle to the helix by specifying a value in the Taper Angle spinner available in the Radius variation area of the dialog box Figure ... a helix without a taper angle and Figure 9-6 shows a helix with a taper angle CREATING SURFACES The tools provided in Wireframe and Surface Design workbench to create simple and complex surfaces...
- 40
- 434
- 1
A real time approach to process control 2ed
Ngày tải lên :
01/01/2014, 17:44
... concepts as fundamentals of chemical engineering For undergraduate programs looking to transition away from the traditional mathematical-based approach to a more applied, hands-on approach, this ... typically busy with the day -to- day operation of the plant, simulation tools that are difficult to understand and use will never see any of the truly practical and value-adding applications By allowing ... and Paul Fruehauf from Applied Control Engineering These gentlemen share a passion for the field and a commitment to the practical approach to both teaching and practising process control As with...
- 327
- 548
- 0
Tài liệu Module 6: Working with Cubes and Measures docx
Ngày tải lên :
18/01/2014, 05:20
... that the cube contains at least one measure and at least one dimension, and that all tables included in the cube schema are joined to at least one other table Save and name the cube BETA MATERIALS ... will create a valid cube and browse the resulting data ! To restore a new database and define a data source In Analysis Manager, right-click the server, click Restore Database, click the Look ... that you can set to define its storage and appearance, and the way users interact with its data Key Points Analysis Services uses the Fact Table Size to design aggregations in the cube For the...
- 42
- 629
- 0
Tài liệu Working with String and Selection Classes pdf
Ngày tải lên :
26/01/2014, 11:20
... Background, Buttons, and Actions The Background layer contains the image of the word processor window as well as text fields The Buttons layer contains the four buttons that appear at the top of the word ... this case 5, because that's the number of characters the zipCode_txt field contains The last part of the script uses an if statement to take one set of actions if zipLength equals and another ... statement The first action will display a dynamic text message in the status_txt text field The message is built dynamically by adding "The first instance of these characters occurs at character"...
- 10
- 290
- 0
Tài liệu A Public Health Approach to Children’s Mental Health - A Conceptual Framework pdf
Ngày tải lên :
12/02/2014, 12:20
... to apply strategies that promote the mental health and whole health of individuals, while still working to prevent and ameliorate factors that threaten their health A Public Health Approach to ... discipline that practices mental health treatment and care, and it is the language used by the WHO and other world organizations to refer to the concept They also note that the word “mental” can also ... converging to suggest that now is the ideal time for action First, countries such as Australia, New Zealand, and Canada have begun to implement changes to their approaches with promising early results34,35...
- 141
- 470
- 0
Tài liệu A Client-Centered Approach to Reproductive Health: A Trainer’s Manual docx
Ngày tải lên :
13/02/2014, 10:20
... as training tools and as useful tools to energize and relax participants They are explained within the module when they are to be used TRAINING MATERIALS AND TOOLS Training materials are a resource ... Having said that, the fundamentals of participatory training are repeated and reinforced throughout the manual as a reminder, and to encourage those who may have had less advanced training to ... Zeba Tasneem and Tayyaba Gul were also an essential part of the core team during earlier trainings in Sargodha The manual was edited earlier by Mary D’Souza It was later transformed into the shape...
- 287
- 500
- 0
Tài liệu Báo cáo khoa học: "A Ranking-based Approach to Word Reordering for Statistical Machine Translation" doc
Ngày tải lên :
19/02/2014, 19:20
... Search and Learning for the Linear Ordering Problem with an Application to Machine Translation Ph.D Thesis Karthik Visweswariah, Jiri Navratil, Jeffrey Sorensen, Vijil Chenthamarakshan and Nandakishore ... translation from English to several SOV languages The drawback for hand-crafted rules is that they depend upon expert knowledge to produce and are limited to their targeted language pairs Automatically ... rest 75% as test data (auto) We sample a small corpus (575 sentence pairs) and manual alignment (man-small) We denote the automatic alignment for these 575 sentences as (auto-small) From Table 3,...
- 9
- 615
- 0