working toward a new treatment for wet age related macular degeneration

Báo cáo y học: " Cost-effectiveness of ranibizumab for neovascular age-related macular degeneration" pot

Báo cáo y học: " Cost-effectiveness of ranibizumab for neovascular age-related macular degeneration" pot

Ngày tải lên : 13/08/2014, 11:22
... ranibizumab arm Year to 10 progression rates of the geographic atrophy form of age- related macular degeneration As for base-case As for base-case As for base-case Year MARINA data, sham arm Year MARINA ... ratios, an approach that is standard in the United States The availability of ranibizumab is therefore likely to transform the management of neovascular macular degeneration, a disease that can ... not vary with visual acuity Estimates for Model Variables Visual acuity before treatment The distribution of visual acuity for patients with neovascular age- related macular degeneration at the...
  • 11
  • 306
  • 0
Báo cáo y học: " Response of a simian immunodeficiency virus (SIVmac251) to raltegravir: a basis for a new treatment for simian AIDS and an animal model for studying lentiviral persistence during antiretroviral therapy" pptx

Báo cáo y học: " Response of a simian immunodeficiency virus (SIVmac251) to raltegravir: a basis for a new treatment for simian AIDS and an animal model for studying lentiviral persistence during antiretroviral therapy" pptx

Ngày tải lên : 12/08/2014, 23:23
... well as according to animal care standards deemed acceptable by the Association for the Assessment and Accreditation of Laboratory Animal Care International (AAALAC) All experiments were performed ... 5’ GGCACTATTGGAGCTAAGAC 3’ (reverse primer), SIV-P 6FAM-AGATTTGGATTAGCAGAAAGCCTGTTGGA-TAMRA (TaqMan probe) The signal was finally compared to a standard curve of known concentrations from 107 ... subcutaneously with PMPA, 20 mg/kg/day, and FTC, 50 mg/kg/day Quantitative assay for SIVmac251 viral RNA levels For measurement of plasma SIVmac251 RNA levels, a quantitative TaqMan RNA reverse transcription-PCR...
  • 19
  • 317
  • 0
A new vision for old age rethinking health policy for europes ageing society

A new vision for old age rethinking health policy for europes ageing society

Ngày tải lên : 06/12/2015, 23:05
... country’s healthcare system Policymakers have a dual challenge ahead: to ensure high standards of care for ageing populations, while also maintaining the financial sustainability of state health and ... system as a whole (46%); negative attitudes towards older people/ ageism among healthcare professionals (42%); and a lack of strategic preparation for an increasingly ageing population (39%) As the ... on a good footing to manage population-ageing in a sustainable way Population health interventions, for example—addressing the social determinants of health—can increase healthy life expectancy...
  • 42
  • 185
  • 0
AGE RELATED MACULAR  DEGENERATION –   THE RECENT ADVANCES   IN BASIC RESEARCH  AND CLINICAL CARE potx

AGE RELATED MACULAR  DEGENERATION –   THE RECENT ADVANCES   IN BASIC RESEARCH  AND CLINICAL CARE potx

Ngày tải lên : 27/06/2014, 15:20
... Basic and Translational Research Wet Age Related Macular Degeneration Fardad Afshari, Chris Jacobs, James Fawcett and Keith Martin University of Cambridge, UK Introduction Age related macular ... modalities for neovascular age- related macular degeneration Cochrane Database Syst Rev 2008 Apr 16;(2):CD005139 Virgili G, Bini A Laser photocoagulation for neovascular agerelated macular degeneration ... Photodynamic Therapy: Working Toward a New Treatment for Wet Age- Related Macular Degeneration 213 Ira Probodh and David Thomas Cramb Chapter 12 Clinical Application of Drug Delivery Systems for Treating...
  • 310
  • 372
  • 0
THOÁI HÓA HOÀNG ĐIỂM Ở NGUỜI CAO TUỔI (Age – related Macular Degeneration) docx

THOÁI HÓA HOÀNG ĐIỂM Ở NGUỜI CAO TUỔI (Age – related Macular Degeneration) docx

Ngày tải lên : 26/07/2014, 09:21
... thấy tăng huỳnh quang sớm từ hắc mạc Những biểu nhánh tân mạch dạng lưới vòng bánh xe Giai đoạn sau tăng huỳnh quang mạnh nhanh toàn nâng tân mạch thấm huỳnh quang tổ chức xung quanh muộn Những ... loại d a vào lâm sàng chủ yếu d a huỳnh quang Tuỳ thuộc vào có mặt dấu hiệu: o Tân mạch nhìn thấy (Néovaisseau visible) o Tân mạch không nhìn thấy (Néovaisseau occulte) o Bong biểu mô sắc tố ... tổn o thương o Ở sau: Tăng huỳnh quang nhanh toàn vùng teo biểu mô sắc tố (Hiệu c a sổ)  Loại thứ 2: Có kèm theo thoái hoá drusen Trên huỳnh quang thấy nhiều mảng tăng huỳnh quang rải rác đến...
  • 7
  • 281
  • 0
Age-Related Macular Degeneration - part 1 ppt

Age-Related Macular Degeneration - part 1 ppt

Ngày tải lên : 09/08/2014, 16:21
... 267 Surgical Treatment for AMD Submacular Surgery for Patients with Age- Related Macular Degeneration P Kumar Rao and Matthew A Thomas 277 16 Limited Macular Translocation Kah-Guan Au Eong, Gildo ... of Age- Related Macular Degeneration Scott W Cousins and Karl G Csaky Clinical Features of AMD Nonexudative Macular Degeneration Neelakshi Bhagat and Christina J Flaxel 67 Geographic Atrophy Sharon ... Mark J Rivellese, Adam Martidis, and Elias Reichel IV Current and Experimental Medical Treatment for Exudative AMD Laser Photocoagulation for Choroidal Neovascularization in Age- Related Macular...
  • 56
  • 223
  • 0
Age-Related Macular Degeneration - part 3 pps

Age-Related Macular Degeneration - part 3 pps

Ngày tải lên : 09/08/2014, 16:21
... Sorenson JA Age- related macular degeneration and choroidal neovascularization Am J Ophthalmol 1993;115:786–791 68 Macular Photocoagulation Study Group Argon laser photocoagulation for neovascular maculopathy: ... of Age- related Macular Degeneration with Photodynamic Therapy (TAP) Study Group Principal Investigators Photodynamic therapy of subfoveal choroidal neovascularization in age- related macular degeneration ... Thermotherapy and radiation treatment are also being evaluated for treatment of occult CNV V ALTERNATIVE TREATMENTS TO PHOTOCOAGULATION Alternatives to laser photocoagulation are mainly for subfoveal...
  • 56
  • 243
  • 0
Age-Related Macular Degeneration - part 4 docx

Age-Related Macular Degeneration - part 4 docx

Ngày tải lên : 09/08/2014, 16:21
... 1982;100:912–918 Treatment of Age Related Macular Degeneration with Photodynamic Therapy (TAP) Study Group Photodynamic therapy of subfoveal choroidal neovascularization in age- related macular degeneration ... recurrent neovascularization after laser photocoagulation for subfoveal choroidal neovascularization of age- related macular degeneration Arch Ophthalmol 1994;112:489–499 22 Macular Photocoagulation Study ... neovascularization caused by age- related macular degeneration: results of retreatments in a phase and study Arch Ophthalmol 1999;117:1177–1187 53 Freund KB, Yannuzzi LA, Sorenson JA Age- related macular...
  • 56
  • 235
  • 0
Age-Related Macular Degeneration - part 5 ppsx

Age-Related Macular Degeneration - part 5 ppsx

Ngày tải lên : 09/08/2014, 16:21
... The Radiation Therapy for Age- related Macular Degeneration (RAD) Study Group, A prospective, randomized, double-masked trial on radiation therapy for neovascular age- related macular degeneration ... experimental treatment methods, theoretical advantages of radiation therapy include absence of iatrogenic mechanical or laser damage or systemic side effects (38) An additional advantage to radiation treatment ... Age- related macular degeneration and blindness due to neovascular maculopathy Arch Ophthalmol 1984;102:1640–1642 American Academy of Ophthalmology Age- Related Macular Degeneration, Preferred Practice...
  • 56
  • 258
  • 0
Age-Related Macular Degeneration - part 6 pptx

Age-Related Macular Degeneration - part 6 pptx

Ngày tải lên : 09/08/2014, 16:21
... choroidal neovascularization, and systemic vascular disease in patients with age- related macular degeneration Am J Ophthalmol 1998; 125:71–80 44 Green WR, Enger C Age- related macular degeneration ... Submacular scar excision in age- related macular degeneration Int Ophthalmol 1991;15:215–222 Treatment of Age- related Macular Degeneration with Photodynamic Therapy (TAP) Study Group Photodynamic ... Submacular Surgery for Patients with AMD A B C 283 D Figures (A) Color photograph of a patient with geographic atrophy and a subretinal neovascular membrane due to age- related macular degeneration...
  • 56
  • 187
  • 0
Age-Related Macular Degeneration - part 7 docx

Age-Related Macular Degeneration - part 7 docx

Ngày tải lên : 09/08/2014, 16:21
... vessels associated with drusen Late stages of ARM, also called age- related macular degeneration Age- related macular degeneration (AMD) is a later stage of ARM and includes both “dry” and wet AMD ... of and Age Limits in Age- Related Macular Degeneration (Age- Related Maculopathy) Used in Population-Based Studies Framingham Eye Study (2): An eye was diagnosed as having senile macular degeneration ... we all speak the same language? Br J Ophthalmol 1998;82:1104–1105 10 Group IAES An international classification and grading system for age- related maculopathy and age- related macular degeneration...
  • 56
  • 257
  • 0
Age-Related Macular Degeneration - part 8 pps

Age-Related Macular Degeneration - part 8 pps

Ngày tải lên : 09/08/2014, 16:21
... senile macular degeneration following cataract extraction Am J Ophthalmol 1979;87(1):77–83 Pollack A, Marcovich A, Bukelman A, Oliver M Age- related macular degeneration after extracapsular cataract ... Hypertension, cardiovascular disease, and age- related macular degeneration Age- Related Macular Degeneration Risk Factors Study Group Arch Ophthalmol 2000;118(3):351–358 Ferris FL Senile macular degeneration: ... Evidence for protection against age- related macular degeneration by carotenoids and antioxidant vitamins Am J Clin Nutr 1995;62(Suppl):1448S– 1461S Young RW Solar radiation and age- related macular degeneration...
  • 56
  • 199
  • 0
Age-Related Macular Degeneration - part 9 ppt

Age-Related Macular Degeneration - part 9 ppt

Ngày tải lên : 09/08/2014, 16:21
... Stargardt-like macular degeneration Candidate linkage analysis Candidate gene analysis Candidate linkage analysis 12,80,82,84 Candidate gene analysis 80,82,131 Dominant North Carolina macular dystrophy ... Dominant progressive bifocal chorioretinal atrophy Dominant retinal cone dystrophy Candidate linkage analysis 80,82 Candidate linkage analysis Candidate linkage analysis Candidate linkage analysis ... technological advances in 452 Au Eong et al Table Advantages and Disadvantages of Subretinal Versus Epiretinal Approach for the Retinal Prosthesis Subretinal approach Advantages Prosthesis is located at the...
  • 56
  • 208
  • 0
Age-Related Macular Degeneration - part 10 ppsx

Age-Related Macular Degeneration - part 10 ppsx

Ngày tải lên : 09/08/2014, 16:21
... Melia M, Humayun M, Schachat AP, Hartranft CD Limited inferior macular translocation for the treatment of subfoveal choroidal neovascularization secondary to age- related macular degeneration Am ... Photodynamic therapy of subfoveal choroidal neovascularization in age- related macular degeneration with verteporfin: one-year results of randomized clinical trials— TAP report Treatment of age- related ... membrane facing upward Removing each apical layer sequentially exposed the RPE basal lamina, inner collagen layer, elastin layer, and outer collagen layer First-passage human RPE harvested from a...
  • 52
  • 275
  • 0
Báo cáo y học: "ost-effectiveness of smoking cessation to prevent age-related macular degeneration" doc

Báo cáo y học: "ost-effectiveness of smoking cessation to prevent age-related macular degeneration" doc

Ngày tải lên : 13/08/2014, 11:22
... studies analysed the smoking profiles of a total of 1,488 people with age- related macular degeneration We extracted data on the relative risk of age- related macular degeneration for ex-smokers relative ... of age- related macular degeneration. [7] Ranibizumab is the first treatment for age- related macular degeneration that improves visual acuity and its efficacy has been described as miraculous.[38] ... based on the 5-year incidence of late agerelated maculopathy in the Beaver Dam Eye Study,[12] and the proportions of geographic atrophy and neovascular age- related macular degeneration estimated...
  • 10
  • 230
  • 0
Báo cáo y học: "High-molecular-weight hyaluronan – a possible new treatment for sepsis-induced lung injury: a preclinical study in mechanically ventilated rats" ppsx

Báo cáo y học: "High-molecular-weight hyaluronan – a possible new treatment for sepsis-induced lung injury: a preclinical study in mechanically ventilated rats" ppsx

Ngày tải lên : 13/08/2014, 11:22
... Critical Care Vol 12 No Liu et al reverse primer, 5'-TCA CAG AGC AAT GAC TCC AAA G-3'; and GAPDH (internal control) forward primer, 5'-AAT GCA TCC TGC ACC ACC AA-3' and reverse primer, 5'-GTA GCC ATA ... connected to a Harvard apparatus ventilator (model 55-7058; Harvard Apparatus, Holliston, MA, USA) The rats were then ventilated Page of 11 (page number not for citation purposes) with a tidal volume ... was lavaged with normal saline for measurement of cell counts and cytokines, macrophage inflammatory protein-2 (MIP-2) and TNFα The right lung was flash frozen for the myeloperoxidase assay, for...
  • 11
  • 297
  • 0
Báo cáo y học: "Rasburicase represents a new tool for hyperuricemia in tumor lysis syndrome and in gout Lisa Cammalleri and Mariano Malaguarnera"

Báo cáo y học: "Rasburicase represents a new tool for hyperuricemia in tumor lysis syndrome and in gout Lisa Cammalleri and Mariano Malaguarnera"

Ngày tải lên : 31/10/2012, 14:59
... hyperuricemia [21-24] Contemporary use of alkalinization, hydration and rasburicase at 0.10 mg/kg for 3-5 days maintains the same efficacy [25] Anyway, we may have favourable issues by changing the ... renal impairment Standard measures to prevent and treat hyperuricemia include allopurinol and alkalinization, associated with an aggressive hydration Rasburicase presents various features that ... because each metabolic derangement is associated with remarkable clinical manifestations Hyperuricemia and hyperphosphatemia severely worsen renal functionality; hyperkalemia and hypocalcemia...
  • 11
  • 715
  • 0
Tài liệu The Book Of Personal Transformation - How To Use Ancient Wisdom To Create A New Life For Yourself docx

Tài liệu The Book Of Personal Transformation - How To Use Ancient Wisdom To Create A New Life For Yourself docx

Ngày tải lên : 15/12/2013, 06:15
... lives AFFIRMATIONS Jeff Staniforth, the creator of Sculptor 3, an amazing software that can make affirmations work for anyone, has this to say about affirmations: “By definition, an affirmation ... poem like a mantra as often as I can remember: Thank you for the abundance, Thank you for the wealth; Thank you for all the happiness, Protections and Good Health Repeat this mantra consistently ... a certain prejudice towards certain people or race, try to make an extra effort to love them unconditionally For example, if you are biased against Muslims in general, make an extra effort to...
  • 59
  • 770
  • 3
A new algorithm for enumeration of minimum cutsets of graph by branch addition

A new algorithm for enumeration of minimum cutsets of graph by branch addition

Ngày tải lên : 03/01/2014, 19:35
... Billinton and C Singh, ''Generating capacity reliability evaluation in interconnected systems using a frequency and duration approach, Part I: Mathematical analysis,'' IEEE Trans on Power Apparatus ... node are shown in Table The calculations have made by Matlab version 6.5 The cutsets of this graph have calculated in 0.8 second This algorithm also has applied to a part of Iran transmission and ... Enumeration of Minimal Cutsets Separating Vertices in a Class of Undirected Planar Graphs," IEEE Trans on Reliability, Vol 41, No 1, March 1992 Li Yan, Hamdy A Taha, Thomas L Landers, "A Recursive...
  • 6
  • 545
  • 0