working reportviewer with a complex business object with a nested generic list type property as data source for local reports

The a and b adapters are used as priming sites for both amplification

The a and b adapters are used as priming sites for both amplification

Ngày tải lên : 19/03/2014, 22:32
... ssDNA bead to be loaded into a well • Enzyme beads and packing beads are added Enzyme beads containing sulfurase and luciferase, and packing beads used only to keep the DNA beads in place • Above ... • The strands are denatured using sodium hydroxide to release the ssDNA template library (sstDNA) The Adapters • The A and B adapters are used as priming sites for both amplification and sequencing ... adapter contains a 5’ biotin tag used for mobilization • The beads are magnetized and attract the biotin in the B adaptors Filtering the Mess • There are four adaptor combinations that are formed...
  • 19
  • 390
  • 0
Báo cáo hóa học: " Research Article A New Inverse Halftoning Method Using Reversible Data Hiding for Halftone Images" docx

Báo cáo hóa học: " Research Article A New Inverse Halftoning Method Using Reversible Data Hiding for Halftone Images" docx

Ngày tải lên : 21/06/2014, 08:20
... displays the LUT information and structure and is denoted as LH (LUT data header) 3.3 Overhead Information and Data Embedding The overhead information includes two kinds of data; SH is the pattern ... image S with pair-based method and generated another stego image S 3.4 Data Extract and Recovering Grayscale Image In data extracting process, we extract 8+TC ∗ 18 bits of SH from the last raw ... in a reversible way Relatively large amounts of secret data are embedded into a cover image so that the decoder can extract the hidden secret data and restore the original cover image without any...
  • 13
  • 328
  • 0
Báo cáo Y học: Secretion of a peripheral membrane protein, MFG-E8, as a complex with membrane vesicles A possible role in membrane secretion pptx

Báo cáo Y học: Secretion of a peripheral membrane protein, MFG-E8, as a complex with membrane vesicles A possible role in membrane secretion pptx

Ngày tải lên : 24/03/2014, 03:21
... domain was then amplified by PCR from the cloned plasmid with primers containing an EcoRI site at the 5¢ end (5¢-TAGAATTCCACCATGCAGGTCTCCCGT-3¢) and an EcoRV site at the 3¢ end (5¢-CAGATATCTTAACAGC ... serum and peroxidase-labeled goat anti-(rabbit IgG) Ig as the secondary antibody, and peroxidase activity was measured Scanning electron microscopy Samples for scanning electron microscopy analysis ... N.I., Lasierra, P., Larrad, L., Pineiro, A. , Alava, M .A & Naval, J (1999) Activated human T cells release bioactive Fas ligand and APO2 ligand in microvesicles J Immunol 163, 1274–1281 27 Mather,...
  • 10
  • 517
  • 0
Báo cáo y học: " The working alliance in a randomized controlled trial comparing online with face-to-face cognitive-behavioral therapy for depression" pptx

Báo cáo y học: " The working alliance in a randomized controlled trial comparing online with face-to-face cognitive-behavioral therapy for depression" pptx

Ngày tải lên : 11/08/2014, 16:21
... groups In addition, bivariate and partial correlations (Pearson) were calculated to examine the relationship between the working alliance and therapy outcome Treatment outcome was assessed as (a) the ... B.W and B.P carried out analysis and interpretation of data, and drafted the manuscript All authors read and approved the final manuscript Acknowledgements The authors would like to thank Andrea ... that is a good predictor of psychotic episodes Because no data are yet available from a German norm group, the Dutch norm data were used Anxiety Anxiety was assessed using the Anxiety subscale...
  • 33
  • 371
  • 0
A three phase voltage type PWM rectifier with the function of an active power filter

A three phase voltage type PWM rectifier with the function of an active power filter

Ngày tải lên : 03/01/2014, 19:44
... forphase v which is given by (11) can also be obtained in the same manner as that explained above for phase U EXPERIMENTAL INVESTIGATION To confirm the operation of the three-phase PWM rectifier with ... sinusoidal waveform in compliance with the sinusoidal reference signal and , that the current i has a nearly rectangular waveform due to the existence of a smoothing reactor Fig3(b) shows the waveform ... KataokaT 1996, nt -type PWM rectifier with active filtering function", IEEJ SPC- 96 (107), 11-20 ( in Japanese) KataokaT, Murota 1, Fuse Y, Nakajima D and Nishikata S 1999, A Single-phase Voltage-Type...
  • 6
  • 479
  • 1
Tài liệu Updating a Data Source with Data from a Different Data Source doc

Tài liệu Updating a Data Source with Data from a Different Data Source doc

Ngày tải lên : 21/01/2014, 11:20
... tracks changes made to data by maintaining multiple versions of each row allowing the data to be reconciled later to a data source using a DataAdapter The data source to which the DataSet is reconciled ... contains data and schema information within its contained objects, but not information about the provider that was used to retrieve the data or the original source of the data The DataSet tracks ... // private void UpdateDataFromDifferentDataSourceForm_Load (object sender, System.EventArgs e) { // Create the DataAdapter for the source records daSource = new SqlDataAdapter("SELECT *...
  • 4
  • 326
  • 0
Báo cáo khoa học: A novel antifungal hevein-type peptide from Triticum kiharae seeds with a unique 10-cysteine motif doc

Báo cáo khoa học: A novel antifungal hevein-type peptide from Triticum kiharae seeds with a unique 10-cysteine motif doc

Ngày tải lên : 07/03/2014, 02:20
... CGCTGGTTCTTGCCAGTCTCAGTGCCGTGGTTGCTAGGGAT TTTAGCACCACGAGCCTGGTCACCGCAACGCTGAGC CGCAGAAGCCGTACTTACCACAGCACAGGCAGTTCG GACTGGCAAGAACCAGCGCCACAGTAAGCGTCACCA GCTAGGATCCCTAGCAACCACGGCAC Table Antifungal activity ... Odintsova et al chitinases and 1,3-b-glucanases, proteinases and some other enzymes, proteinase and a- amylase inhibitors, thaumatin-like proteins and antimicrobial peptides (AMPs) AMPs form a highly ... activity of peptides was assayed against several Gram-positive and Gram-negative bacteria using radial diffusion assay Petri dishes with Luria–Bertani agar were seeded with test bacteria The peptide...
  • 10
  • 505
  • 0
Báo cáo khoa học: A pathway through interferon-c is the main pathway for induction of nitric oxide upon stimulation with bacterial lipopolysaccharide in mouse peritoneal cells pot

Báo cáo khoa học: A pathway through interferon-c is the main pathway for induction of nitric oxide upon stimulation with bacterial lipopolysaccharide in mouse peritoneal cells pot

Ngày tải lên : 17/03/2014, 10:20
... American Type Culture Collection (Manassas, VA, USA) and maintained in our laboratory, was also used For cell culture, RPMI-1640 (Dainippon Pharmaceutical Co Ltd, Osaka, Japan) supplemented with ... H2SO4 and the absorbance was measured at 450 nm Quantification of each cytokine (in ngÆmL)1 for IFN-c and in pgÆmL)1 for IL-12p70) was performed based on the standard curve in each assay Preparation ... stimulated with the indicated stimulants Culture supernatant obtained at 24 h was assayed to determine the concentrations of IFN-c and IL-12p70, and culture supernatant obtained at 48 h was assayed...
  • 10
  • 395
  • 0
Báo cáo khoa học: Structure of a trypanosomatid mitochondrial cytochrome c with heme attached via only one thioether bond and implications for the substrate recognition requirements of heme lyase potx

Báo cáo khoa học: Structure of a trypanosomatid mitochondrial cytochrome c with heme attached via only one thioether bond and implications for the substrate recognition requirements of heme lyase potx

Ngày tải lên : 23/03/2014, 04:21
... sickness (Trypanosoma brucei), Chagas disease (Trypanosoma cruzi), and leishmaniasis (Leishmania species)] Note that some euglenozoans, such as E gracilis, also contain a chloroplast with typical CXXCH ... observation that heme lyase is unable to mature a bacterial class I c -type cytochrome, Paracoccus denitrificans cytochrome c550 [33] Moreover, many taxa that have heme lyase apparently have separate ... heme attachment to cytochrome c in yeast, heme lyase, can mature a trypanosomatid cytochrome c Heme lyases can mature AXXCH variants of yeast or human cytochrome c, albeit at a lower level than the...
  • 11
  • 513
  • 0
Báo cáo Y học: A nuclear-encoded CK2-type chloroplast enzyme with redox-sensitive function docx

Báo cáo Y học: A nuclear-encoded CK2-type chloroplast enzyme with redox-sensitive function docx

Ngày tải lên : 24/03/2014, 04:21
... apparatus from mustard, we took advantage of the known phosphorylation pattern of a partially purified PEP -A RNA polymerase that contains associated PTK activity (kinase– polymerase complex; heparin–Sepharose ... kinase activity after heat treatment at 50 °C for 10 (lane 3) When the heat-treated fraction was supplemented with recombinant cpCK 2a and again tested for kinase activity (lane 2), a phosphorylation ... chloroplast transcription apparatus was initially borne out byinvitrostudies onpurified plastidRNApolymerasePEP -A [20,21] It was shown that this polymerase contains an associated serine/threonine kinase...
  • 9
  • 391
  • 0
Báo cáo khoa học: RNA helicase A interacts with nuclear factor jB p65 and functions as a transcriptional coactivator pot

Báo cáo khoa học: RNA helicase A interacts with nuclear factor jB p65 and functions as a transcriptional coactivator pot

Ngày tải lên : 30/03/2014, 15:20
... luciferase assay Luciferase activity was measured by the Luciferase Assay System (Promega, Madison, WI) as described previously [26] Transfection efficiency was monitored by Renilla luciferase activity ... recombinant TNF -a was purchased from Roche interference RNA (siRNA) 5¢-GCAUAAAACUUCUGC GUCU-3¢ was targeted to the RHA portion from 2408 to 2426 Control siRNA 5¢-AUUCUAUCACUAGCGU GAC-3¢ was purchased ... to grow for days at 30 °C At least three colonies of each transformant were tested for b-galactosidase activity using X-gal colony filter assay (Clontech) +, positive for b-galactosidase activity...
  • 11
  • 485
  • 0
RUBBER PRODUCTION IN LIBERIA: An Exploratory Assessment of Living and Working Conditions, with Special Attention to Forced Labor docx

RUBBER PRODUCTION IN LIBERIA: An Exploratory Assessment of Living and Working Conditions, with Special Attention to Forced Labor docx

Ngày tải lên : 31/03/2014, 09:21
... important as it makes it easier to pay back loans taken up in the past (see Debt below) This was mainly an issue at LAC; as the Cocopa plantation, at the time of research, was not giving loans to staff ... contractor may take on a specific task, for example tapping a certain field or number of trees or clearing an area for replanting He or she would agree with management on a certain fee for the task The ... country – LAC – as well as one of the smaller company-owned producers (Cocopa) LAC has a labor force of about 3000 workers (regular and seasonal) and a total population of 25,000, making it second...
  • 53
  • 511
  • 0
picture yourself building a website with joomla! 1.6[electronic resource] step-by-step instruction for creating a high-quality, professional-looking site with ease

picture yourself building a website with joomla! 1.6[electronic resource] step-by-step instruction for creating a high-quality, professional-looking site with ease

Ngày tải lên : 29/05/2014, 23:54
... use it After you create a database, you must associate a user with a username and password with the database Joomla! asks you for that information during the installation process so, again, write ... chapter, you learned the following: Ǡ Installing Joomla! 1.6 requires a series of steps on a Webserver Ǡ A MySQL database with a username, password, and database name is required Ǡ The database ... for the database type If all has gone well, after the connection to the database, the next screen asks for FTP information You can bypass this It is only relevant for use with certain types of...
  • 320
  • 858
  • 0
báo cáo hóa học: " The AMC Linear Disability Score (ALDS): a cross-sectional study with a new generic instrument to measure disability applied to patients with peripheral arterial disease" potx

báo cáo hóa học: " The AMC Linear Disability Score (ALDS): a cross-sectional study with a new generic instrument to measure disability applied to patients with peripheral arterial disease" potx

Ngày tải lên : 18/06/2014, 19:20
... hypercholesterolemia, history of coronary artery disease or cerebrovascular disease In patients with IC, we measured ABI at rest and after exercise In patients with CLI, we measured ABI at rest and TP Quality ... (24%) Endovascular revascularization 36 (58%)) Surgical revascularization (13%) Amputation (5%) ABI at rest (in patients with CLI) Decrease ABI after exercise (in patients with IC )a 0.35 (0-0.59) ... this reason, we used the VascuQol, and especially its Activity domain, as benchmark for the ALDS analyses Construct validity was confirmed by a relatively strong association of the ALDS with the...
  • 8
  • 386
  • 0
báo cáo hóa học: "Usability of a virtual reality environment simulating an automated teller machine for assessing and training persons with acquired brain injury" pdf

báo cáo hóa học: "Usability of a virtual reality environment simulating an automated teller machine for assessing and training persons with acquired brain injury" pdf

Ngày tải lên : 19/06/2014, 08:20
... same tasks - cash withdrawals and money transfers - with the VR-ATM or the real ATM in a rehabilitation hospital For the real ATM practice, the therapist issued the participant an ATM card, a ... making a money transfer, since the cash withdrawal task was simple and had fewer steps compared with the money transfer task VR technology can serve as a program for repetitive practice in a simulated ... behavioral checklists were developed based on activity analysis, a 14-item one for cash withdrawals and a 17-item one for money transfers, to assess the participants' performance in using ATMs...
  • 9
  • 454
  • 0
báo cáo hóa học:" Engagement of patients in religious and spiritual practices: Confirmatory results with the SpREUK-P 1.1 questionnaire as a tool of quality of life research" ppt

báo cáo hóa học:" Engagement of patients in religious and spiritual practices: Confirmatory results with the SpREUK-P 1.1 questionnaire as a tool of quality of life research" ppt

Ngày tải lên : 20/06/2014, 15:20
... is an important covariate for CRP and ExP, but not for USP • Educational level is a covariate for USP and ExP • Gender andMarital status are covariates only for ExP • Age is not a relevant covariate ... that an R-S- attitude was associated with the lowest engagement scores for all five forms of a SpR practice Variance analyses confirmed that SpR attitude and religious affiliation are the main ... sub-scales, we performed analysis of univariate variance (ANOVA) All statistical analyses were performed with SPSS for Windows 10.0 Results Reliability Reliability analysis revealed that item...
  • 11
  • 425
  • 0
báo cáo hóa học:" The AMC Linear Disability Score (ALDS): a cross-sectional study with a new generic instrument to measure disability applied to patients with peripheral arterial diseas" potx

báo cáo hóa học:" The AMC Linear Disability Score (ALDS): a cross-sectional study with a new generic instrument to measure disability applied to patients with peripheral arterial diseas" potx

Ngày tải lên : 20/06/2014, 16:20
... hypercholesterolemia, history of coronary artery disease or cerebrovascular disease In patients with IC, we measured ABI at rest and after exercise In patients with CLI, we measured ABI at rest and TP Quality ... (24%) Endovascular revascularization 36 (58%)) Surgical revascularization (13%) Amputation (5%) ABI at rest (in patients with CLI) Decrease ABI after exercise (in patients with IC )a 0.35 (0-0.59) ... this reason, we used the VascuQol, and especially its Activity domain, as benchmark for the ALDS analyses Construct validity was confirmed by a relatively strong association of the ALDS with the...
  • 8
  • 335
  • 0
Báo cáo y học: "Proton-pump inhibitors are associated with a reduced risk for bleeding and perforated gastroduodenal ulcers attributable to non-steroidal anti-inflammatory drugs: a nested case-control study" pptx

Báo cáo y học: "Proton-pump inhibitors are associated with a reduced risk for bleeding and perforated gastroduodenal ulcers attributable to non-steroidal anti-inflammatory drugs: a nested case-control study" pptx

Ngày tải lên : 09/08/2014, 10:20
... patient, if a malignancy of the stomach was diagnosed or if another reason for upper intestinal bleeding (such as esophagogastric varices, arteriovenous malformations, diffuse gastritis or Mallory–Weiss ... Yeomans ND, Tulassay Z, Juhasz L, Racz I, Howard JM, van Rensburg CJ, Swannell AJ, Hawkey CJ, for the ASTRONAUT study group: A comparison of omeprazole with ranitidine for ulcers associated with ... as were data on actual medication used Other groups have studied populations of up to several thousand patients, but associations were derived by coupling databases and the validity of the data...
  • 8
  • 459
  • 0
Báo cáo y học: "Association of common polymorphisms in known susceptibility genes with rheumatoid arthritis in a Slovak population using osteoarthritis patients as control" doc

Báo cáo y học: "Association of common polymorphisms in known susceptibility genes with rheumatoid arthritis in a Slovak population using osteoarthritis patients as control" doc

Ngày tải lên : 09/08/2014, 14:20
... anti-CCP-positive RA cases with anti-CCP-negative OA controls revealed several association signals, whereas anti-CCP-negative RA cases did not [see Tables S17 and S18 in Additional data file 1] Assuming a dominant ... female RA-OA case-control sample Table S5 lists the SNP association analysis results in RA patients with rheumatoid factor (RF) vs RA patients without RF Table S6 lists the SNP association analysis ... in rheumatoid arthritis (RA)osteoarthritis (OA) case-control sample Table S3 lists the SNP association analysis results in male RA casecontrol sample Table S4 lists the SNP association analysis...
  • 10
  • 356
  • 0