with a staging area and data marts
Báo cáo y học: "The emerging modern face of mood disorders: a didactic editorial with a detailed presentation of data and definitions" potx
Ngày tải lên :
08/08/2014, 23:21
... retardation appears, and it includes reduction or disappearance of spontaneous motor activity, slumped posture and gaze, reduced and slow speech and great fatigue Stupor appears in younger patients ... refractory to explanations, confrontation and to a significant extent they lack self-examination and insight; because of this lack of insight, mania nearly always, sooner or later, acquires a delusional ... malignancy Suicide Today we know that suicide is a complex and multicausal behaviour and demands a complex and sophisticated approach Statistics point to a substantial decline of suicide rates throughout...
- 22
- 421
- 0
Configuring a Stub Area and a Totally Stubby Area
Ngày tải lên :
27/10/2013, 08:15
... configuring Area as a stub area, SanJose3 automatically propagates a default route into Area Use the following commands to configure the stub area: SanJose3(config)#router ospf SanJose3(config-router) #area ... stub areas and are replaced with a default route Step You decide that stub area configuration is not making a significant-enough impact on Area Because Capetown can use the default route to its ABR ... ABR for all nonlocal area traffic, you decide to filter Type and Type interarea routes from Area To this, you must configure Area as a totally stubby area, which is a Cisco proprietary feature...
- 5
- 361
- 0
Báo cáo hóa học: " Expression of the RNA-binding protein RBM3 is associated with a favourable prognosis and cisplatin sensitivity in epithelial ovarian cancer" ppt
Ngày tải lên :
18/06/2014, 16:20
... assisted with data collection and helped to draft the manuscript JB assisted with collection of clinical data MU assisted with data collection and participated in its design FP assisted with data collection ... M, Bjorling E, Agaton C, Szigyarto CA, Amini B, Andersen E, Andersson AC, Angelidou P, Asplund A, Asplund C, et al: A human protein atlas for normal and cancer tissues based on antibody proteomics ... primer: 5′-GGG TAC CCA CGC GAA TCA C3′), SDHA (forward primer: 5′-TGG GAA CAA GAG GGC ATC TG-3′, reverse primer 5′-CCA CCA CTG CAT CAA ATT CAT G-3′) and UBC (forward primer: 5′-ATT TGG GTC GCG...
- 12
- 531
- 0
báo cáo hóa học: "Personal customizing exercise with a wearable measurement and control unit" potx
Ngày tải lên :
19/06/2014, 10:20
... area After every session, we uploaded about 8-MB of measured data, including HR and EMG signals, to the central server and stored it in the database Figure shows three HR-γARV-MPF scatter graphs, ... biosignals Users wearing this unit can take advantage of various exercise programs using a variety of exercise machines A prototype of the wearable unit measured heart rate and EMG signals and wirelessly ... showed how a wearable unit could be applied to an Internet-based cycle ergometer exercise system The wearable unit was able to store small amounts of temporal data, and the completed data was processed...
- 10
- 581
- 0
Báo cáo hóa học: " Research Article A New Hilbert-Type Linear Operator with a Composite Kernel and Its Applications" pot
Ngày tải lên :
21/06/2014, 07:20
... UK, 1934 B C Yang, “On a more accurate Hardy-Hilbert-type inequality and its applications,” Acta Mathematica Sinica, vol 49, no 2, pp 363–368, 2006 Chinese B Yang, “On a more accurate Hilbert’s ... inequality,” International Mathematical Forum, vol 2, no 37–40, pp 1831–1837, 2007 W Zhong, A Hilbert-type linear operator with the norm and its applications,” Journal of Inequalities and Applications, ... 2 Journal of Inequalities and Applications where the constant factors π and π are the best possible also Expression 1.2 is called a more accurate form of 1.1 Some more accurate inequalities...
- 18
- 340
- 0
Báo cáo lâm nghiệp:" Comparison of soil water-contents as measured with a neutron probe and time domain reflectometry in a " ppsx
Ngày tải lên :
08/08/2014, 01:21
... porosity at each point (cm3 cm–3), and a is the anisotropy coefficient of the medium Based on experimental data, Jacobsen et al [10] have shown that a varies between 0.4 and 0.8, and Zakri et al [35] ... TDR, also obtained a higher bias with higher q values Finally, Salas Comparison between neutron probe and TDR Table III Summary of the ANOVA results (two-way ANOVA with paired-values): (a) Probe ... above sea level Climate: Humid Mediterranean Mean annual rainfall: 1580 mm a 1 Mean annual temperature: 10.4 ºC Potential evapotranspiration: 800 mm a 1 Bedrock: Paleozoic, schists, grauwackes...
- 9
- 353
- 0
báo cáo khoa học: "Immediate breast reconstruction with a saline implant and AlloDerm, following removal of a Phyllodes tumor" pdf
Ngày tải lên :
09/08/2014, 01:24
... nipple-sparing mastectomy The superior or inferior periareolar with lateral extension, transareolar with perinipple and lateral-medial extension, transareolar and transnipple incision with medial and ... disease of the epithelial and stroma tissue in the breast It is classified as benign, borderline, and malignant Malignant tumors have high stroma cellularity and tend to be permeative whereas ... place, and the implant was filled A drain was inserted and the incision was closed with Monocryl and Dermabond For symmetry, the other breast underwent vertical mastopexy and positioned by making...
- 5
- 453
- 0
báo cáo khoa học: "Imperforate anus with a rectovestibular fistula and pseudotail: a case report" pps
Ngày tải lên :
11/08/2014, 02:21
... representing an association of birth defects including vertebral anomalies, anal atresia, cardiovascular anomalies, tracheoesophageal fistula, esophageal atresia, renal or radial anomalies, and limb ... our hospital on her first day of life for evaluation and management of imperforate anus and a perineal mass The 20-year-old mother had standard prenatal care and an uncomplicated pregnancy She ... Figure Magnetic resonance imaging of pseudotail and sacrum This T2 fat-saturated coronal image demonstrates absence of a presacral mass, relatively normal appearance of the sacrum, and dilated rectum...
- 5
- 343
- 0
Cosmological model with a local void and observational constraints
Ngày tải lên :
16/10/2015, 15:34
... showed that the HZS [1, 2] and the SCP data [3] could be fit without a cosmological constant Since then, many years have passed, and more Sne Ia data have now been obtained with higher accuracy Also, ... such as galaxy clusters, filaments, and voids gradually appear The over-density region has stronger gravitational attraction and, accordingly, it causes a larger deceleration of the expansion rate ... compilation even without the cosmological constant component Besides, it is found that standard parameters used in Tomita’s paper [35] are inconsistent with the new dataset, and new standard parameters...
- 68
- 100
- 0
Báo cáo y học: " Treatment of oroantral fistula with autologous bone graft and application of a non-reabsorbable membrane"
Ngày tải lên :
25/10/2012, 11:48
... and clavulanic acid g The fixed partial prosthesis was removed and the contiguous mucosa appeared healthy A buccal full thickness flap was harvested and the presence of a small OAF was verified ... J, Waikakul A, Pairuchvej V Clinically significant oroantral communications a study of incidence and site Int J Oral Maxillofac Surg 1994;23:19-21 Haas R, Watzak G, Baron M, Tepper G, Mailath ... OAC/OAF; the apexes of tooth 26 were in extremely close approximation to the maxillary sinus, and an area of periapical rarefaction was evident (Fig 1) After the failure of the endodontic treatment...
- 5
- 573
- 0
Propelling Business Growth With A Secure And Continuous Information Infrastructure
Ngày tải lên :
24/04/2013, 20:04
... from tape and validated Application: restored from tape and validated Data: restored from tape and validated Connectivity: restored and validated Redundancy of data: recover lost transaction ... transaction and validate Redundant site: ready (warm site) Recovery plans: ready OS: restored from tape and validated Application: restored from tape and validated Data: restored from tape and ... up to (+/-) days +/- 24 hours up to (+/-) days Sync = data loss Async = acceptable data loss *(Potential for data loss for Async) Sync = data loss Async = acceptable data loss Recovery...
- 27
- 346
- 0
Tài liệu HOW INTERNET PROTOCOL-ENABLED SERVICES ARE CHANGING THE FACE OF COMMUNICATIONS: A LOOK AT VIDEO AND DATA SERVICES ppt
Ngày tải lên :
18/02/2014, 00:20
... generating realtime ratings data is unprecedented Ensure that the underlying signal area data is accurate Local broadcasters must be able to easily communicate changes in their signal area They ... putting up an antenna A broadcaster’s signal reach is also their copyright reach, i.e., only those that can get it with an antenna can watch/listen to it with an antenna By installing an antenna, the ... anywhere in America FiOS gives consumers a super-fast broadband data experience, at speeds of up to 30 megabits downstream and megabits upstream As we move forward, the bandwidth and upstream capacity...
- 99
- 514
- 0
Tài liệu Báo cáo khoa học: Efficient killing of SW480 colon carcinoma cells by a signal transducer and activator of transcription (STAT) 3 hairpin decoy oligodeoxynucleotide – interference with interferon-c-STAT1-mediated killing pdf
Ngày tải lên :
18/02/2014, 08:20
... carcinoma cells Oncogene 20, 2499–2513 Kanda N, Seno H, Konda Y, Marusawa H, Kanai M, Nakajima T, Kawashima T, Nanakin A, Sawabu T, Uenoyama Y et al (2004) STAT3 is constitutively activated and supports ... RHN(CH2)6CATTTCCCGTAATCGAAGATTACGGGAAATG-(CH2)3 NHR (hpST3dODN), which was derived from the seruminducible element of the human c-fos promoter, and RHN(CH2)6- CATTTCCCTTAAATCGAAGATTTAAG GGAAATG-(CH2)3NHR ... conclude that it interacts with the activated forms of STAT3 and STAT1 The actions of STAT3 and STAT1 are highly entangled, they also have antagonistic activities, and they regulate each others activity...
- 11
- 558
- 0
Tài liệu Báo cáo khoa học: Four divergent Arabidopsis ethylene-responsive element-binding factor domains bind to a target DNA motif with a universal CG step core recognition and different flanking bases preference pptx
Ngày tải lên :
18/02/2014, 13:20
... of a three-stranded antiparallel b-sheet and an a- helix, packed approximately parallel to the b-sheet, with the seven thoroughly conserved amino acids (Arg6, Arg8, Trp10, Glu16, Arg18, Arg26 and ... performed as described previously [9] Selection of the DNA-binding site A 60 bp single-stranded DNA RDM10, with 10 randomized oligonucleotides in the center, i.e CTGTCAGTGAT GCATATGAACGAATN10AATCAACGACATTAGGATC ... from amino acid sequence data Anal Biochem 182, 319–326 Liu Q, Kasuga M, Sakuma Y, Abe H, Setsuko M, Yamaguchi-Shinozaki K & Shinozaki K (1998) Two transcription factors, DREB1 and DREB2, with an...
- 10
- 464
- 1
Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx
Ngày tải lên :
19/02/2014, 05:20
... GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAGCTGTCACTCAGCCGCAGCAG GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCC GCGGGATCCCTGGACGGGCAGCCGATGAAG ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT ... GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCGTGAATAATCTGCACCCTCGA ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT ... AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT GCGAAGCTTCACGATGCCCAAGAAGAAGCCGACGCC GCGGGATCCCGGATGCTGGCAGCGTGGGTTGG...
- 14
- 517
- 0
Tài liệu Báo cáo khoa học: Plant a-amylase inhibitors and their interaction with insect a-amylases ppt
Ngày tải lên :
21/02/2014, 03:20
... T aestivum None 1,2 and BIII S cereale S cereale HSA HSA and PPA AAI A hypochondriacus None activity CAI PAI Zeamatin V.unguiculata C cajan Z mays None HSA and PPA None activity SIa1, SIa2 and ... [12,18,31,149] a- AI2 Wheat Extract P vulgaris T aestivum None activity PPA and HSA 0.19 T aestivum PPA and HSA 0.53 T aestivum HSA and PPA (low) 0.28 WRP25 T aestivum T aestivum PPA and HSA None WRP26 T aestivum ... insect-resistant transgenic plants In some cases, the a- amylase inhibitors act only against mammalian a- amylases or, on the contrary, just against insect a- amylases In the latter case, this provides a highly...
- 16
- 539
- 0
Tài liệu Biodiversity and Local Perceptions on the Edge of a Conservation Area, Khe Tran Village, Vietnam doc
Ngày tải lên :
21/02/2014, 04:20
... Poaceae/bamboo Calamus walkeri /rattan Acacia auriculiformis/Acacia Musaceae/banana Wendlandia glabrata/tree Licuala spinosa/Licuala palm Tarrietia javanica/tree Cleistanthus aff myrianthus/tree Melocalamus ... rice farming Land for pepper farming Land for rubber farming Land for natural forest Land for grass/bare land Pahy/O Lau river Tu moi tributary Land for houses Mountain peak of 935 Rana waterfall ... and hard soil surface Le Trong Trai et al (2001) argued that with an abundance of heavily degraded land available for rehabilitation, forest management and other land uses, there is considerable...
- 118
- 556
- 0
Breast cancer risk in relation to occupations with exposure to carcinogens and endocrine disruptors: a Canadian case–control study pptx
Ngày tải lên :
06/03/2014, 02:21
... Luginaah I, Laukkanen E, Hellyer D, Reinhartz A, Watterson A, Abu-Zahra H, Maticka-Tyndale E, Schneider K, Beck M, Gilbertson M: Occupation and breast cancer: a Canadian case– control study Ann ... Breast Cancer Society of Canada, Windsor Essex County Cancer Centre Foundation, and Green Shield Foundation The Canada Research Chair for Social Justice and Sexual Health provided software and data ... jobs and year in prior high-exposed farm work Table Breast cancer odds ratios (matched analysis) and menopausal status with BMI and selected risk factors and major sectors, by conditional logistic...
- 17
- 461
- 0