with a little help from my friends guitar chords and lyrics
Tài liệu Báo cáo khoa học: Control of the coagulation system by serpins Getting by with a little help from glycosaminoglycans pptx
... Glycosaminoglycan kass (M)1Æs)1) Antithrombin Thrombin – Heparin Heparan High affinity heparin Heparin pentasaccharide – Heparin Heparan High affinity heparin Heparin pentasaccharide – Dermatan sulfate ... Pike et al (GAGs) [3] Glycosaminoglycans such as heparin, heparan sulfate and dermatan sulfate have been found to significantly accelerate the interaction between serpins and coagulation proteases, ... interaction with the protease [18,19] Given the plasma concentration of AT and the rates of interaction in the presence and absence of heparin pentasaccharide (Table 1), one can calculate that...
- 10
- 668
- 0
With a Little Help pptx
... leather sofa that made amiable exhalations of good tobacco smell mixed with years of saddle soap when he settled into it Randy reached onto a tall mahogany bookcase and handed him down a first-aid kit ... and streamed away as fast as his mind's hand could write them But as always, he was finally able to master his mind, 38 to find relaxation and calm at the bottom of the thrashing, churning vat ... of despair When Randy came in, Lawrence heard each bolt click and the hiss of air as from a great distance, and he surfaced from his calm, watching Randy cross the floor bearing his own chair "Innocent...
- 282
- 494
- 0
Báo cáo khoa học: " Protection of chickens from Newcastle disease with a recombinant baculovirus subunit vaccine expressing the fusion and hemagglutinin- neuraminidase proteins" pdf
... Gene amplified size (bp) 1,701 1,795 1,719 1,779 Primer sequence 5' TCCAGGTGCAAGATGGGCTCC 3' 5' AGGGAAACCTTCGTTCCTCAT 3' 5' TCAATCATGGACCGCGCCGTT 3' 5' CGCAGAAGATAGGTGATACAA 3' 5' ACATTCAGGACACAATATGGG ... fusion and hemagglutininNeuraminidase antigens Avian Dis 1996, 40, 770-777 Iritani Y, Aoyama S, Takigami S, Hayashi Y, Ogawa R, Yanagida N, Saeki S, Kamogawa K Antibody response to Newcastle disease ... Nakazawa H, Sumida M, Matsubara F, Aoyama S, Iritani Y, Hayashi Y, Kamogawa K Expression of the Newcastle disease virus (NDV) fusion glycoprotein and vaccination against NDV challenge with a recombinant...
- 8
- 315
- 0
Báo cáo khoa học: "Studies on mastitis, milk quality and health risks associated with consumption of milk from pastoral herds in Dodoma and Morogoro regions, Tanzania" pdf
... elttac derbssorC dna ubeZ ni sititsam enivoB T arahijuF ,D egarabmaK ,R ugnahcaM ,AF ahsoM ,NM mehS 53 773-273 ,41 ,1002 icS minA J tsuA-naisA ainaznaT fo saera laciport ni smraf elacs egral dna ... orogoroM dna ahabiK ni rotces gnimraf yriad redlohllams ni sesonooz enrob klim dna sititsam fo stnanimreted dna ecnelaverP MD egarabmaK ,T nekoL ,A onarujnaM ,B alubaK ,F airaviK ,A aladnuB ,MF akuruT ... yduts eht ni devlovni osla erew seitinummoc amukuS larotsap-orga dna iasaaM larotsap eht yb yltnanimoderp detibahni )alabmaK dna awakaD-imaW ,odnihuL-imaW ,eniokoS-imaW yleman( noiger orogoroM ni...
- 9
- 399
- 0
How to Help With Math Homework - When the Answers Aren’t in the Book (A Guide for Students, Families, & Friends) pot
... William Blatner Photos by William Blatner and Jackie Rigali How to Help With Math Homework When The Answers Aren’t in the Book Many math curricula, such as the Interactive Math Program (IMP) and ... to Help With Math Homework When The Answers Aren’t in the Book, (A Guide for Students, Families, and Friends) Copyright 2000 by William Blatner Pamphlet layout and design by Jeremiah Beaudry and ... Estimating can help us understand the problem better and suggest other steps we can take Suggest the student make a diagram A picture or diagram of the situation can often clarify the relationships...
- 12
- 480
- 0
Tài liệu Gynecological cancer patients’ differentiated use of help from a nurse navigator: a qualitative study ppt
... appointment with the physician, and afterwards followed up with regard to information on the disease and the treatment plan, and answered questions from the patient and possible accompanying relative ... set up a standard for psychosocial healthcare to cancer patients, a standard that could be met by using an NN to make need assessments, link appropriate services to patients and make a subsequent ... relationship with a special and for many a long-known healthcare person and this relationship was given as a reason for not using the extra help from the NN The interactions with these healthcare persons...
- 11
- 695
- 0
Tài liệu Báo cáo Y học: Caged O2 Reaction of cytochrome bo3 oxidase with photochemically released dioxygen from a cobalt peroxo complex doc
... bo3 exhibits a broad Soret peak at 425 nm and bands at 530 and 560 nm in the dark Upon irradiation with a Xe lamp (Fig 4) or with an excimer laser after 15 laser flashes at 308 nm with an intensity ... cytochrome c oxidase from Paracoccus denitrificans Nature 376, 660–669 Tsukihara, T., Aoyama, H., Yamashita, E., Tomizaki, T., Yamaguchi, H., Shinzawa-Itoh, K., Nakashima, R., Yaono, R & Yoshikawa, S (1995) ... evacuated to 8–10 mbar residual pressure The sample containment, maintained at °C, was purged with dry air to minimize absorbance by water vapor A water-cooled globar was used as source of radiation,...
- 8
- 474
- 0
Báo cáo khoa học: Molecular design of a nylon-6 byproduct-degrading enzyme from a carboxylesterase with a b-lactamase fold ppt
... Shibata N, Takeo M, Negoro S & Higuchi Y (2005) Crystallization and x-ray diffraction analysis of 6-aminohexanoate-dimer hydrolase from Arthrobacter sp KI72 Acta Crystallogr F61, 928–930 Hatanaka ... 203–206 Kato K, Fujiyama K, Hatanaka HS, Prijambada ID, Negoro S, Urabe I & Okada H (1991) Amino acid alterations essential for increasing the catalytic activity of the nylon-oligomer degradation ... code: 2ZMA) have 2554 Table Data collection and refinement statistics A Hyb-24D and Hyb-24D -A1 12–Ald Hyb-24D Data collection Space group Unit cell parameters ˚ a = b (A) ˚ c (A) ˚ Wavelength (A) Resolution...
- 10
- 625
- 0
Báo cáo khoa học: A novel antifungal hevein-type peptide from Triticum kiharae seeds with a unique 10-cysteine motif doc
... CGCTGGTTCTTGCCAGTCTCAGTGCCGTGGTTGCTAGGGAT TTTAGCACCACGAGCCTGGTCACCGCAACGCTGAGC CGCAGAAGCCGTACTTACCACAGCACAGGCAGTTCG GACTGGCAAGAACCAGCGCCACAGTAAGCGTCACCA GCTAGGATCCCTAGCAACCACGGCAC Table Antifungal activity ... Escherichia coli and assays of recombinant WAMP 1a activity against diverse plant pathogens, such as chitin-containing and chitin-free fungi, and Grampositive and Gram-negative bacteria The amino acid ... Odintsova et al chitinases and 1,3-b-glucanases, proteinases and some other enzymes, proteinase and a- amylase inhibitors, thaumatin-like proteins and antimicrobial peptides (AMPs) AMPs form a highly...
- 10
- 505
- 0
Báo cáo khóa học: A new UV-B absorbing mycosporine with photo protective activity from the lichenized ascomycete Collema cristatum docx
... were harvested immediately following irradiation and analysed for pyrimidine dimer formation Non-irradiated cells and cells irradiated through a naked quartz plate served as controls As can be ... acid or an amino-alcohol [11] In contrast, MAAs are UV absorbing metabolites of algae that contain an aminocyclohexenimine ring system, with UV absorption maxima between 310 and 360 nm To date, ... in cyanobacteria Cells with high concentrations of MAAs are approximately 25% more resistant to UV radiation centered at 320 nm than those with no or low concentrations of MAAs [25] MAAs have...
- 5
- 450
- 0
Báo cáo khoa học: The effect of replacing the axial methionine ligand with a lysine residue in cytochrome c-550 from Paracoccus versutus assessed by X-ray crystallography and unfolding ppt
... 0.4 A Significant deviations for main- and side-chain atoms in the ligand loop containing the K100 are however, observed To accommodate K100 as a ligand a number of main-chain atoms are displaced ... diffraction data of the wt and M100K crystals were collected on an in-house beam using a MAR345 Image Plate detector The crystals were mounted in a capillary and datasets at 295 K and were measured ... single-exponential decay in the program Origin Acknowledgements J .A. R.W and A- M.M.R are grateful to Dr N.S Pannu for help with data processing and answers to numerous questions J .A. R.W and G.W.C are grateful...
- 15
- 509
- 0
Báo cáo khoa học: Characterization of a digestive carboxypeptidase from the insect pest corn earworm (Helicoverpa armigera) with novel specificity towards C-terminal glutamate residues pptx
... SDS/PAGE Carboxypeptidase assays and expression of HaCA42 mRNA Carboxypeptidase assays using the synthetic substrates furylacryloyl-Phe-Phe (FAPP), furylacryloyl-Ala-Lys (FAAK) and FAEE and Northern ... in the databases The two proteins migrating at 50 and 55 kDa (bands A and B; Fig 1A) were identified from their N-terminal sequences as similar to a- amylase (accession no AAA17751) from silkworm ... Glutamate carboxypeptidase activity in H armigera larvae Activity towards synthetic substrates for carboxypeptidase A and B (FAPP and FAAK) has previously been characterized in gut extracts from...
- 12
- 458
- 0
Báo cáo khoa học: NMR solution structure of Cn12, a novel peptide from the Mexican scorpion Centruroides noxius with a typical b-toxin sequence but with a-like physiological activity doc
... constrains (see Materials and methods) Over 250 structures were calculated, from which 19 with the smallest total energy and no NOE ˚ violations greater than 0.2 A and no angle constraints violations ... from rat; NaV1.7 from human; Para from fruit fly; NachB1 from squid) Conserved residues are indicated by asterisks, and conservative replacements by dots Acidic amino acids in the extracytoplasmic ... nonredundant sequences of Na+ channels available in databases were aligned with CLUSTAL X [45] The segments S5–S6 of domain I and S3–S4 of domain IV from selected sequences are shown (NaV1.1, 1.4 and...
- 13
- 434
- 0
Báo cáo khoa học: Antimicrobial peptides from hylid and ranin frogs originated from a 150-million-year-old ancestral precursor with a conserved signal peptide but a hypermutable antimicrobial domain pot
... antimicrobial peptides from South American hylids [32,34–37] and Asian, European AMWKDVLKKIGTVALHAGKAALGAVADTISQa GLWSKIKEVGKEAAKAAAKAAGKAALGAVSEAVa ALWKNMLKGIGKLAGQAALGAVKTLVGAE ALWKDILKNVGKAAGKAVLNTVTDMVNQa ... isolated India between 150 and 65 Ma and colonized the Laurasian land mass after India collided with Asia Abbreviations; AF, Africa; IND, India; AUS, Australia; SA, South America; ANT, Antartica ... B, H and G and brevinins 2Ta and 2Tb are from Rana temporaria, brevinins 1E and 2Ef and esculentin 1B from R esculenta, ranalexin from R catesbeiana, gaegurins and from R rugosa, and ranatuerin-2P...
- 14
- 305
- 0
Báo cáo khoa học: Interaction of ostreolysin, a cytolytic protein from the edible mushroom Pleurotus ostreatus, with lipid membranes and modulation by lysophospholipids pptx
... ultracentrifuged and the sediments and supernatants obtained were analyzed (A) lane 1, Pharmacia low molecular mass standards; lane 2, ostreolysin (noncentrifuged); lane 3, ostreolysin (supernatant); lane ... the 90 polarizer, and S are order parameters calculated from the ratio of the parallel and perpendicular absorption bands SL is for the lipid chains, derived from the symmetric and asymmetric ... order parameter for the amide IÂ band (between 1600 and 1700 cm)1, with h ẳ ) The integrals were calculated from the corrected spectra, that with sufx L from the lipid alone, and that with sufx amide...
- 12
- 492
- 0
Báo cáo khoa học: Identification of critical residues of subunit H in its interaction with subunit E of the A-ATP synthase from Methanocaldococcus jannaschii potx
... 5¢-GTTGCCA TGGCTGTGAAATTGATGGGA-3¢ (forward), 5¢-CTCCG AGCTCTCATGGCAGTTTAAC-3¢ (reverse) and 5¢-ATA CCATGGAACAGCCAGAGTATAAAG-3¢ (forward), 5¢AGGGAGCTCTCAGAATAACTTCTCTGTA-3¢ (reverse), respectively, ... was obtained from ATTO-TEC (Siegen, Germany) All other chemicals were at least of analytical grade and were purchased from BIOMOL (Hamburg, Germany), Merck (Darmstadt, Germany), Roth (Karlsruhe, ... Assignment of subunits E and H in A- ATP synthase S Gayen et al Low-resolution structures of the enzyme show that the A1 ATPase is rather elongated, with an A3 :B3 headpiece and an elongated...
- 10
- 351
- 0
Báo cáo khoa học: Functional interaction of Escherichia coli heat-labile enterotoxin with blood group A-active glycoconjugates from differentiated HT29 cells docx
... Tecnologica (BID 1201 ⁄ OC-AR, PICT 05–10607) ´ and Secretarı´ a de Ciencia y Tecnica de la Universidad ´ Nacional de Cordoba (SeCyT-UNC), Argentina EMG was a fellow from CONICET and GAR and CGM are ... measured by the method of Lowry et al [41] Glycohydrolases (sucrase, maltase and lactase) and aminopeptidase N activities were determined in P2 fractions according to Messer and Dalqvist [42] and ... sheets, and immunostained as previously described [16] The sucrase–isomaltase complex was identified using a mouse anti-(human sucraseisomaltase) IgG (kindly donated by Dr A Quaroni, Ithaca, NY, USA)...
- 10
- 238
- 0
images of empiricism essays on science and stances with a reply from bas van fraassen nov 2007
... Library Cataloguing in Publication Data Data available Library of Congress Cataloging in Publication Data Data available Typeset by Laserwords Private Limited, Chennai, India Printed in Great Britain ... isn’t as clear as van Fraassen would like to believe Chakravartty maintains that almost all inquiry is metaphysical to a degree, including van Fraassen’s stance empiricism Chakravartty also argues ... philosophical stance at all It is clear that van Fraassen has synoptic ideas about the virtues of empiricism and the nature of philosophy, but it is not always clear what van Fraassen’s ideas are The...
- 401
- 1,306
- 0
báo cáo hóa học: " Self-efficacy instruments for patients with chronic diseases suffer from methodological limitations - a systematic review" pdf
... http://www.hqlo.com/content/7/1/86 cacy instruments for patients with the chronic diseases diabetes, COPD, asthma, arthritis, and heart failure We synthesized the data in a narrative way and used absolute numbers and proportions ... 14 16 17 Bandura A: Self-efficacy: Toward a unifying theory of behavioral change Psychological Review 1977, 84(2191-215): Bandura A: Social foundations of thought and action: A social cognitive ... M, Havermans G: A self-efficacy scale for children and adolescents with asthma: construction and validation Journal of Asthma 1992, 29(2):99-108 Talbot F, Nouwen A, Gingras J, Gosselin M, Audet...
- 10
- 483
- 0
Báo cáo sinh học: "Functional characterization of human Cd33+ And Cd11b+ myeloid-derived suppressor cell subsets induced from peripheral blood mononuclear cells co-cultured with a diverse set of human tumor cell lines" docx
... on a BD FACSCalibur flow cytometer and data acquisition and analysis were performed as above Data are from three unique donors and expressed as a fraction of labeled cells within a live-cell gate ... MDSC samples (4-998 osteogenic sarcoma, DU 145 prostate carcinoma, CAKI-1 renal cell carcinoma, SKOV-3 ovarian carcinoma, and SW 608 and SW 732 colorectal adenocarcinoma cell lines), we analyzed ... isolated by magnetic bead separation (Miltenyi Biotec) and used for functional studies Arginase activity was measured in cell lysates using Bioassay Systems’ QuantiChrom Arginase Assay Kit (Hayward,...
- 20
- 575
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008