why use a single page website
Use a Single Web Form to Update Multiple Lookup Tables
Ngày tải lên :
07/11/2013, 15:15
... System.Web.UI.WebControls.DataGridPageChangedEventArgs)
Handles dgLookupData.PageIndexChanged
' Set the current page in the data grid.
Me.dgLookupData.CurrentPageIndex = e.NewPageIndex
10. Add the ...
Function GetPageRows() As Integer
' This helps synchronize the data table rows
' with the DataGrid page and row.
GetPageRows = dgLookupData.PageSize * dgLookupData.CurrentPageIndex ...
ListBox Name lstLookupTables
AutoPostback True
Label Name Label2
Text Lookup Table Data:
DataGrid Name dgLookupData
AllowPaging True
PageSize 5
Label Name Label3
Text Errors:
Another...
- 19
- 276
- 0
Tài liệu Use a Single Windows Form to Update Multiple Lookup Tables Just about every database application pptx
Ngày tải lên :
14/12/2013, 20:16
... System.EventArgs) Handles
lstLookupTables.SelectedIndexChanged
Dim dtData As New DataTable()
Try
' Update the data adapter and data table to reflect the new data,
' and reassign ... data table directly.
dtFromGrid = CType(dgTableData.DataSource, DataTable)
' Commands necessary to actually post back to server.
modaLookupData.Update(dtFromGrid)
dtFromGrid.AcceptChanges() ... the modaLookupData data adapter,
and it is used to update the data table. The Update method of modaLookupData is
executed, followed by the AcceptChanges method of the dtFromGrid data table....
- 6
- 356
- 0
Use a Fixed Server Role
Ngày tải lên :
07/11/2013, 15:15
... in a fixed server role does not grant access to a database or data within the
databases. Fixed server roles are intended for administrators and assistant administrators
and do not automatically ... automatically grant access to any of the data that SQL Server manages.
Database object permissions (discussed later in this chapter in How-To 11.10) are
required to gain access to data and database objects. ... failing to carefully implement security can have a dramatic negative impact on every
database that SQL Server manages.
Members of the SQL Server BUILTIN/Administrators group are automatically...
- 5
- 273
- 0
Bài soạn chèn hình ảnh cho website
Ngày tải lên :
25/11/2013, 00:11
... phí, sau đó copy đ a
chỉ c a hình ảnh để đ a vào website.
Sau đây là vài ví dụ về đ a chỉ c a các file hình:
http://img339.imageshack.us/img339/8241/flower32ot.jpg
http://img428.imageshack.us/img428/732/flower24cm.jpg
http://img428.imageshack.us/img428/4341/flower19vd.jpg
...
Bạn sẽ nhận được hình sau:
Bạn sẽ nhận được hình sau đây:
Sau khi copy đ a chỉ file hình, paste vào mục File name.
Xin lưu ý: Dùng phím Ctrl+V để paste.
Sau đó nhấp vào nút Insert.
Bạn ... đ a chỉ c a hình ảnh)
Khi chèn hình ảnh từ web, bạn cũng làm tương tự như hướng dẫn ở trên.
Nhấp vào mục Web để mở ra hình sau đây:
Copy đ a chỉ file hình, paste vào mục Alternative...
- 7
- 324
- 0
Tài liệu Retrieving a Single Value from a Query pdf
Ngày tải lên :
14/12/2013, 18:16
... compared to retrieving a single value using an
output parameter or using a DataReader, it allows a single value to be returned with the
least code and may therefore improve readability and maintainability. ... ExecuteScalar( ) method of the Command object returns a single value from the data
source rather than a table or data stream. While the ExecuteScalar( ) method does not
result in a performance ... therefore improve readability and maintainability.
If the result set returns more than one result, the first column of the first row is returned
as a scalar value. A null reference is returned if...
- 2
- 312
- 0
Tài liệu Using a Single Stored Procedure to Update Multiple Changes to a SQL Server Database pdf
Ngày tải lên :
21/01/2014, 11:20
... the changes made to the DataSet passed in
as an NText input parameter @data. The parameters @data and @datadeleted
contain an XML representation of a DataSet containing all updated and added ... StoredProcedureMultipleRowsForm_Load(object sender,
System.EventArgs e)
{
ds = new DataSet( );
// Create the DataAdapter.
SqlDataAdapter da = new SqlDataAdapter("SELECT * FROM " + TABLENAME,
ConfigurationSettings.AppSettings["Sql_ConnectString"]); ... ds.GetChanges(
DataRowState.Added | DataRowState.Modified).WriteXml(sw,
XmlWriteMode.WriteSchema);
cmd.Parameters.Add("@data", SqlDbType.NText);
cmd.Parameters["@data"].Value...
- 7
- 442
- 0
Tài liệu Hyperlink from a Row in the Data Grid to a Detail Page ppt
Ngày tải lên :
21/01/2014, 12:20
... a Row in the Data Grid to a Detail Page
Often, I need to zero in and display data based on a record in the DataGrid control. How
do I display detail information in a separate page from a DataGrid ... Sub Page_ Load(ByVal sender As System.Object,
ByVal e As System.EventArgs) Handles MyBase.Load
'Put user code to initialize the page here
Dim odaProdIndiv As OleDb.OleDbDataAdapter ... to call a detail page.
When you click on a product, another page is displayed, with detail information supplied
(see Figure 5.16).
1. Create a Web Form. Then place the controls in Table...
- 5
- 392
- 0
Tài liệu ADC’s HDSL Interface Panel combines HDSL termination, DSX-1 and DSX-3 into a single shelf doc
Ngày tải lên :
24/01/2014, 12:20
... cable management and high-quality/high-reliability
components that protect the carrier’s investment and ensure network reliability.
Infrastructure Solutions
for FTTX-PON Applications
Central ... North America: +1-952-938-8080 Fax: +1-952-917-3237
For a listing of ADC’s global sales office locations, please refer to our web site.
4 Base Cabinet Sizes
Cabinet Size (HxWxD) Serving Area Size ... Extensive cable management
- Bend radius protection
- Slack storage
- Clear routing paths
ã Parking-lot feature provides cross-connect
functionality at interconnect price
ã Parking-lot feature ensures...
- 4
- 242
- 0
Tài liệu Báo cáo khoa học: "Joint Word Segmentation and POS Tagging using a Single Perceptron" docx
Ngày tải lên :
20/02/2014, 09:20
... segmentation alone (Zhang and Clark,
2007), even with an agenda size as small as 8, and
a simple beam search algorithm also works well for
POS tagging (Ratnaparkhi, 1996). However, when
applied ... character)
12
tag t on a word starting with char c
0
and
containing char c
13
tag t on a word ending with char c
0
and
containing char c
14
tag t on a word containing repeated char cc
15
tag ... partial candidates in all possible ways to gen-
erate new partial candidates. An agenda is used to
control the search space, keeping only the B best
partial candidates ending with the current charac-
ter....
- 9
- 576
- 0
Tài liệu Báo cáo khoa học: A single amino acid substitution of Leu130Ile in snake DNases I contributes to the acquisition of thermal stability A clue to the molecular evolutionary mechanism from cold-blooded to warm-blooded vertebrates docx
Ngày tải lên :
20/02/2014, 23:20
... reagent grade and available commercially. The
snakes and Japanese white rabbits were acquired, main-
tained and used in accordance with the Guidelines for the
Care and Use of Laboratory Animals ... snake (E. quadrivirgata,
E. climacophora and A. blomhoffii), amphibian (X. laevis,
Rana catesbeiana, Bufo vulgaris japonicus and Cynops
pyrrhogaster), avian (chicken) and fish (O. mossambicus)
DNases ... from
Amersham Pharmacia Biotech; Concanavalin A (Con A) -
agarose was from Seikagaku Kogyo (Tokyo, Japan); rabbit
muscle G-actin and salmon testis DNA were from Sigma;
Superscript II reverse transcriptase...
- 8
- 500
- 0
Comparison of the obstetric anesthesia activity index with total delivery numbers as a single denominator of workload demand in Israeli maternity units doc
Ngày tải lên :
05/03/2014, 15:20
... clinical activities other than
epidural analgesia and cesarean anesthesia (including anesthesia for retained placenta and
complicated vaginal deliveries, antenatal or pre-operative consultation, ... obstetric anesthesia workload and that a typical epidural takes
about half the time of a typical cesarean. Accordingly, the OAAI for each hospital was
calculated as ((0.75 * number of epidurals per ... of epidural analgesia and cesarean anesthesia to the
total OAAI in individual hospitals. Data for 2005 (left) and 2007 (right)
The OAAI correlated with epidural rates and cesarean rates more...
- 14
- 610
- 0
Ground Water and Surface Water A Single Resource-U.S. Geological Survey Circular 1139 pot
Ngày tải lên :
06/03/2014, 15:21
... ground water less
than 50 years old, also can be used to calculate ground-water
age in different parts of a drainage basin.
222
Radon is a chemically inert, radioactive gas that has
a half-life ...
lakes than it is in streams. Evaporation generally
has a greater effect on lake levels than on stream
levels because the surface area of lakes is generally
larger and less shaded than many ... reaches of
streams, and because lake water is not replenished
as readily as a reach of a stream. Lakes can be
present in many different parts of the landscape and
can have complex ground-water...
- 87
- 652
- 0
Knut Einar Rosendahl (ed.) Social Costs of Air Pollution and Fossil Fuel Use – A Macroeconomic Approach pdf
Ngày tải lên :
06/03/2014, 16:20
... costs on materials
we see that metals' share of total costs is
larger than metals' share of total material
stocks. The reason is that metals are the
most sensitive materials to SO
2
... e.g., clean air, where the
specific impacts are skipped.
6
The rationale for using integrated analyses
as indicated above, has increased con-
siderably the last decade. New research
has managed to ... case.
First, when air pollution causes e.g.
increased material corrosion and hospital
admissions, more economic resources are
used for maintenance and health care.
However, compared to a situation...
- 147
- 424
- 0
Báo cáo khoa học: A single EF-hand isolated from STIM1 forms dimer in the absence and presence of Ca2+ ppt
Ngày tải lên :
07/03/2014, 00:20
... lumen are sensed by the canonical
EF-hand motif and cause conformational changes in
this motif. The Ca
2+
signal change and the accompa-
nying conformational change in the canonical EF-hand
are ... H-W, Ayalasomayaj-
ula G & Yang J (2006) Prediction of EF-hand calcium
binding proteins and analysis of bacterial EF-hand
proteins. Proteins 65, 643–655.
28 Marti-Renom MA, Stuart AC, Fiser A, ... ER
membrane to form ‘punctae’ and aggregates near the
plasma membrane [1,6]. The N-terminal region of
STIM1 contains a canonical EF-hand motif and a pre-
dicted SAM domain. Stathopulos et al. [23,24]...
- 9
- 465
- 0
Báo cáo khoa học: A single mismatch in the DNA induces enhanced aggregation of MutS Hydrodynamic analyses of the protein-DNA complexes pot
Ngày tải lên :
07/03/2014, 12:20
... underline).
Name Size (nt) Sequence
CLL 121 5Â-TCACCATAGGCATCAAGGAATCGCGAATCCGCCTCGTTCCGGCTAAGTAACATGGAGCAG
GTCGCG
ATTTCGACACAATTTATCAGGCGAGCACCAGATTCAGCAATTAAGCTCTAAGCC- 3Â
GTL 121 5Â-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGA
TCTGCTCC
ATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3Â
GCL ... 5Â-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGA
TCTGCTCC
ATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3Â
GCL 121 5Â-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGA
CCTGCTCC
ATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3Â
CLE ... 5Â-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGA
CCTGCTCC
ATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3Â
CLE 61 5Â-GCCTCGTTCCGGCTAAGTAACATGGAGCAG
GTCGCGGATTTCGACACAATTTATCAGGCGA-3Â
GTE 61 5Â-TCGCCTGATAAATTGTGTCGAAATCCGCGA
TCTGCTCCATGTTACTTAGCCGGAACGAGGC-3Â
GCE...
- 16
- 397
- 0
