white the contribution of gray matter in a glioma to language deficits

Báo cáo y học: "A novel approach to measure the contribution of matrix metalloproteinase in the overall net proteolytic activity present in synovial fluids of patients with arthritis" pptx

Ngày tải lên : 09/08/2014, 08:22

... Yoshihara Y, Nakamura H, Obata K, Yamada H, Hayakawa T, Fujikawa K, Okada Y: Matrix metalloproteinases and tissue inhibitors of metalloproteinases in synovial fluids from patients with rheumatoid arthritis ... several inflammatory disorders, including arthritis MMP-9, in particular, has been implicated in the degradation and damage of articular cartilage in RA and OA [2-4] We thus examined the levels of ... monitoring of activity on a patient may allow adjusting the dosage of a specific inhibitor or, alternatively, exploring whether additional combinatorial treatments are required From a clinical...

10
494
0

Tài liệu The Contribution of Sexual and Reproductive Health Services to the Fight against HIV/AIDS: A Review pptx

Ngày tải lên : 13/02/2014, 15:20

... became feasible and affordable, there appears to be increasing demand, especially in sub-Saharan Africa.75 It is usually provided in three main ways, often depending on the prevalence rates in the ... genital area, and a higher incidence of cervical intraepithelial neoplasia (CIN) and advanced cervical disease, and at younger ages, than women in the general population, a risk which increases ... Mwanza, Rakai and Masaka,6,98–102 all of these attempts at reducing the global STI epidemic can serve as signposts of how to move forward in ways that are beneficial in themselves and have an impact...

23
719
0

Tài liệu THE BACTERIOLOGY OF PULMONARY TUBERCULOSIS IN A POPULATION WITH HIGH HUMAN IMMUNODEFICIENCY VIRUS SEROPREVALENCE ppt

Ngày tải lên : 15/02/2014, 13:20

5
525
0

Tài liệu Báo cáo khoa học: "THE REPRESENTATION OF INCONSISTENT INFORMATION IN A DYNAMIC MODEL-THEORETIC SEMANTICS" ppt

Ngày tải lên : 21/02/2014, 20:20

... expands, the correct denotational relationship is maintained by expanding the image in the table using the ~-expression, and then finding the corresponding element in the model If the element in the ... that was the denotation of the h-expression was not expanded in the same way as the image in this table, a new element corresponding to the expanded image is added to the model This table allows ... undecidability that is the basis of the introduction of inconsistencies into the model To be useful in a natural language understanding system, this mechanism needs to have timely determinations of...

3
394
0

THE CONSTITUTION OF LAW Legality in a Time of Emergency potx

Ngày tải lên : 07/03/2014, 02:20

... to a kind of justice located within the law, justice in the administration of the law Authority and not truth makes law But one who wants to be an authority has to accept the constraints of the ... of in accordance with the rigid doctrine of the separation of powers; and, ﬁnally, functionalism, a theory of the administrative state that seeks to tame the judiciary in order to facilitate the ... judges took to interpreting the laws of apartheid illuminated debates in philosophy of law about the relationship between law and morality My main focus was on the statutory regime put in place to...

268
661
0

THE CONSTITUTION OF LAW Legality in a Time of Emergency docx

Ngày tải lên : 07/03/2014, 02:20

... to a kind of justice located within the law, justice in the administration of the law Authority and not truth makes law But one who wants to be an authority has to accept the constraints of the ... of in accordance with the rigid doctrine of the separation of powers; and, ﬁnally, functionalism, a theory of the administrative state that seeks to tame the judiciary in order to facilitate the ... judges took to interpreting the laws of apartheid illuminated debates in philosophy of law about the relationship between law and morality My main focus was on the statutory regime put in place to...

268
1.1K
0

The Art of Grief The Use of Expressive Arts in a Grief Support Group pptx

Ngày tải lên : 29/03/2014, 04:20

... crucial link in the ability of the group members to find continued meaning in their lives after the death of a love one It is also necessary for the leader to manage the administrative details of ... through the home of a relative, pausing to leaf through the Geographic, or straighten a family photograph on the wall They have earned their ease the hard way, learned to reach through the bramble to ... logical relationship, and the feelings may come all at once in an inexplicable ball of raw emotion You may hear complaints of fatigue, exhaustion, lack of energy, pain, or inability to sleep All of...

324
639
0

báo cáo hóa học:" Quality of life and the impact of drug toxicities in a South African community-based antiretroviral programme" docx

Ngày tải lên : 20/06/2014, 08:20

... onto HAART and increasing survival among these patients, there is a growing need to understand the impact of HAART use on the quality of lives of HIVinfected individuals [4-8] There is a sizeable ... antiretroviral (ARV) therapy progressed to AIDS and died of their disease The rollout of highly active antiretroviral therapy (HAART) through national and provincial programmes has dramatically altered ... [21] In South Africa, there is an ongoing debate about whether or not the side-effect profile of HAART may adversely affect the HRQoL of HIVpositive individuals More data about the impact of HAART...

13
444
0

Báo cáo toán học: "COMPOSITION SUM IDENTITIES RELATED TO THE DISTRIBUTION OF COORDINATE VALUES IN A DISCRETE SIMPLEX" pptx

Ngày tải lên : 07/08/2014, 06:20

... refer to as pictures of weight k A card of weight k is a pair consisting of a picture of weight k and a k-element subset of N that we will call the label set of the card A hand of weight n and ... between the cardinality of the sets of hands and the cardinality of the decks For example, when dealing with labelled graphs, Dk is the set of all connected k-graphs whose vertices are labelled by ... k A card of weight k is a connected k-graph labelled by any k natural numbers Equivalently, a card can be speciﬁed as a picture and a set of natural number labels To construct the card we label...

14
348
0

Báo cáo lâm nghiệp: "Extended length rotation to integrate timber and pine nut production with the conservation of structural diversity in a Pinus pinea (L.) forest" pdf

Ngày tải lên : 07/08/2014, 16:20

... for the estimated age The distribution of the age of the dominant strata and the site index within the forest area can be seen in Figure The classiﬁcation of the forest area in function of the ... shown in Table III can be used to calculate the most likely of the four rot risk classes as a function, for each ﬁxed basal area, of the age and the dominant height of the stand, obtaining for each ... is the number of pairs of samples ua and ua + d which distance from each other is within the distance lag centred at d, and z(ua ) and z(ua +d) are the values that the variable z takes at samplesua...

9
462
0

Báo cáo toán học: "On the number of independent sets in a tree" pdf

Ngày tải lên : 08/08/2014, 11:20

... 0, j The number of matchings in a tree In this section, we turn to the number of matchings in a graph This is also known as the Hosoya index, or the Z-index in mathematical chemistry For a rooted ... the electronic journal of combinatorics 17 (2010), #N18 Consider (T, r) obtained from T1 by joining a new vertex r to r1 Then ϕ(T, r) = (b, b + a) Hence, µ (a, b) ∈ D Inductively adding a leaf ... set as a matching as well Applying the previous technique, we will show the following the electronic journal of combinatorics 17 (2010), #N18 Theorem For m ∈ N, B(m) = Z2 m There are formulae...

5
263
0

Báo cáo khoa học: "Initial mineralization of organic matter in a forest plantation soil following different logging residue management techniques" pps

Ngày tải lên : 08/08/2014, 14:21

... are maintained The main objective of this research was to examine the effect of harvesting and slash management on mineralization of soil organic matter in a forest soil intensively managed In ... Microbial biomass C and N, and mineralizable-N, in litter and mineral soil under Pinus radiata on a coastal sand: influence of stand age and harvest management, Plant Soil 175 (1995) 167–177 [35] Salonius ... given are means and standard errors of three measurements 3.5 N mineralization In the uncut soil, net N mineralization showed a seasonal pattern Most of annual net mineralization took place during...

12
312
0

the age of turbulence adventures in a new world phần 4 docx

Ngày tải lên : 09/08/2014, 19:22

... crises that began with the collapse of the Thai baht and Malaysian ringgit in the summer of 1997 and grew into a threat to the world economy Almost immediately, Thailand and Malaysia plunged into recession ... said, referring to the Fed, the Congress willing, we will remain as the guardian of the purchasing power of the dollar But one factor that will continue to complicate that task is the increasing ... it in a capsule history of U.S central banking I reached all the way back to Alexander Hamilton and William Jennings Bryan and worked my way up to the present and the future (A more general audience...

57
391
0

the age of turbulence adventures in a new world phần 6 pdf

Ngày tải lên : 09/08/2014, 19:22

... origins and workings of capitalism—Marx thought Smith had missed the main point, that capitalism was but a step Marx saw it as a historical stage in an inevitable progression to the revolution of the ... than for a rich man to enter the kingdom of God." The ambivalence toward accumulation of material wealth has a long cultural history that pervades society to this day It has had a profound influence ... heavily invested in loans backed by real estate as collateral, as real estate prices soared When the turn came and prices cascaded downward, the collateral became inadequate But instead of calling...

57
404
0

the age of turbulence adventures in a new world phần 8 ppt

Ngày tải lên : 09/08/2014, 19:22

... stock, the fairly dramatic decline in the average age of the stock, and the creation as a consequence of a high degree of insecurity for those individuals in the labor markets who have to deal ... reflects the opening up of international markets as well as major gains in communication capabilities that inspired the Economist a few years ago to proclaim "the death of distance." In order to facilitate ... net means of financing these investments Every asset must have an owner The market value of "paper" claims against newly created capital assets must equal the market value of those assets In a sense,...

57
396
0

the age of turbulence adventures in a new world phần 10 ppsx

Ngày tải lên : 09/08/2014, 19:22

... implicit in one's current undertaking and pay a royalty to the originator of each one Rather than adopting that obviously unworkable approach, Americans have chosen instead to follow the lead of British ... central planning throughout the world, with China and India in the vanguard The evidence of increasing property rights, and the rule of law more generally leading to increasing levels of material well-being ... acceptance of capitalist practice in the United States for years to come It is not an accident that human beings persevere and advance in the face of adversity Adaptation is in our nature, a fact...

48
338
0

Báo cáo y học: "Acquired hemophilia as the cause of lifethreatening hemorrhage in a 94-year-old man: a case report" pot

Ngày tải lên : 11/08/2014, 03:20

... discharge, his bradycardia had reversed and his heart rate had increased to 85 beats/minute, which suggests that the initial bradycardia was likely related to the infusion of aminocaproic acid ... etiology of acquired hemophilia A remains unclear In approximately half of cases, factor VIII autoantibodies occur in patients without any identifiable cause, while the remaining cases may be associated ... with a ratio of patient’s plasma to normal plasma of 1:1) (Figure 1) Quantitative assays revealed a reduced level of factor VIII activity (1%) and the presence of factor VIII inhibitor measured at...

4
496
0

Báo cáo y học: "Acquired hemophilia as the cause of lifethreatening hemorrhage in a 94-year-old man: a case report" potx

Ngày tải lên : 11/08/2014, 07:20

... discharge, his bradycardia had reversed and his heart rate had increased to 85 beats/minute, which suggests that the initial bradycardia was likely related to the infusion of aminocaproic acid ... etiology of acquired hemophilia A remains unclear In approximately half of cases, factor VIII autoantibodies occur in patients without any identifiable cause, while the remaining cases may be associated ... with a ratio of patient’s plasma to normal plasma of 1:1) (Figure 1) Quantitative assays revealed a reduced level of factor VIII activity (1%) and the presence of factor VIII inhibitor measured at...

4
397
0

Báo cáo khoa hoc:" Study of the impact of perilipin polymorphisms in a French population" docx

Ngày tải lên : 11/08/2014, 08:20

... rs4578621 F : CAAGCTGGGTGCACTGGC 185 R : GAGAAATAGAGGAATTAACC rs6496589 F : CTGCCAACACTCG AGCTG 110 R : ACCTGACTCTTCCTTGTCT rs894160 F1 : GCTGAGACTGAGTCACATGC 403 R1 : GCTGAGACTGAGTCACATGC F2 : CTGTTTGTGGGGCTCCCTCG ... Lipid and lipoprotein levels were measured in a central laboratory Purpan Hospital Biochemical Laboratory (Toulouse) The quality of biological measures was assessed within the framework of the ... et al reported that the A allele was associated with enhanced basal and noradrenaline-induced lipolysis in human subcutaneous fat cells [7], it does not seem to have a major impact in human French...

6
320
0

Báo cáo y học: "Role of vasopressin in the treatment of anaphylactic shock in a child undergoing surgery for congenital heart disease: a case report" docx

Ngày tải lên : 11/08/2014, 11:20

... (NO) and the prostacycline mediated vasodilating pathways [5] Activation of inducible NO synthase (iNOS) is a major contributor to both vasodilatation and resistance to the catecholamine vasopressor ... effects of administered catecholamines [6] Epinephrine has been widely accepted to be the standard medical therapy to reverse cardiovascular collapse in anaphylaxis Because of its α and β adrenergic ... available experiences [12], the above described pharmacological rationale and the choice of avoiding escalating therapy with alpha agonists This pharmacological approach allowed us to titrate the...

4
370
0