when a key is pressed flash checks whether it was the spacebar

báo cáo khoa học: "Best linear unbiased prediction when error vector is correlated with other random vectors in the model" pptx

báo cáo khoa học: "Best linear unbiased prediction when error vector is correlated with other random vectors in the model" pptx

Ngày tải lên : 09/08/2014, 22:23
... to 13 and u and equating to be obtained using a Bayesian approach Differentiating these equations (3.2) A similar result can gives V An example in dairy cattle there is a positive covariance between ... not be guaranteed to converge The advantage of (3.3) is that the inverse of B is not needed and R may be diagonal The order of equations (3.3) would be almost twice as large as that of equations ... which is the same as (2.3) Thus, a model with covariances between u and e can be transformed to an equivalent model with zero covariances between e and u The computational problems depend on the...
  • 6
  • 307
  • 0
Báo cáo khoa học: Intermittent hypoxia is a key regulator of cancer cell and endothelial cell interplay in tumours pot

Báo cáo khoa học: Intermittent hypoxia is a key regulator of cancer cell and endothelial cell interplay in tumours pot

Ngày tải lên : 30/03/2014, 04:20
... Hayakawa M, Miyashita H, Sakamoto I, Kitagawa M, Tanaka H, Yasuda H, Karin M & Kikugawa K (2003) Evidence that reactive oxygen species not mediate NF-kappaB activation EMBO J 22, 3356–3366 Yang ... intermittent hypoxia cycles, and therefore that it is its stabilization that is increased in these conditions [50] HIF- 1a stabilization does not always translate into HIF-1 activity One can therefore ... interleukin-8), and enzymes that lead to extracellular matrix degradation (matrix metalloproteases) [75–78] In addition, NF-jB activation was reported as an early event in malignant transformation in vitro...
  • 12
  • 390
  • 0
Báo cáo khoa học: Myocyte enhancer factor 2 (MEF2) is a key modulator of the expression of the prothoracicotropic hormone gene in the silkworm, Bombyx mori ppt

Báo cáo khoa học: Myocyte enhancer factor 2 (MEF2) is a key modulator of the expression of the prothoracicotropic hormone gene in the silkworm, Bombyx mori ppt

Ngày tải lên : 30/03/2014, 20:20
... black and white images An area adjacent to the area of interest (A) and an area from an image lacking a specimen (N) were scanned as the background signals When PTPCs were not visible, the focal ... [15] There are four isoforms (A D) of mammalian MEF2, and they have high homology within the 56-amino-acid MADS box at their N-termini and within an adjacent 29-amino-acid region referred to as the ... lobes and at the midline in the subesophageal ganglion (SG) (Fig 1A) The axons emanating from the somata of the two pairs of lateral cells extend towards the pars intercerebral with some arborization...
  • 10
  • 437
  • 0
báo cáo hóa học: " “Case files from the University of Florida: When an earache is more than an earache": A case report" potx

báo cáo hóa học: " “Case files from the University of Florida: When an earache is more than an earache": A case report" potx

Ngày tải lên : 21/06/2014, 02:20
... visit and requested admission for observation The ED physician agreed and consulted the pediatric admission team to evaluate the patient After admission was arranged there was a delay in transporting ... Ultimately, it is a moot point as the admitting team did readily admit the patient, so there clearly was little or no issue in that regard After admission Four hours after admission, the physician ... was started on antibiotic therapy and was discharged in good condition days after admission Discussion Brain abscess is a rare diagnosis; there are only 1,500 to 2,500 reported cases each year...
  • 5
  • 329
  • 0
Báo cáo y học: "he miR-17-5p microRNA is a key regulator of the G1/S phase cell cycle transition" pdf

Báo cáo y học: "he miR-17-5p microRNA is a key regulator of the G1/S phase cell cycle transition" pdf

Ngày tải lên : 14/08/2014, 20:22
... Additional data files 13 The following additional data are available with the online version of this paper Additional data file is a table listing the G1/S associated mRNAs predicted to be targets ... NCOA3-D NR 4A3 -A NR 4A3 -B NR 4A3 -C PCAF -A PCAF-C PDGFRA -A PDGFRA-B PDGFRA-C PKD1 -A PKD2 -A PKD2-B PKD2-C PKD2-D PPARA -A PPARA-B PPARA-C PPARA-D PPARA-E PPARA-F PPARA-H PTEN -A RB1 -A RB1-B RB1CC1 -A ... Cordon-Cardo C, Lowe SW, Hannon GJ, Hammond SM: A microRNA polycistron as a potential human oncogene Nature 2005, 435:828-833 Hayashita Y, Osada H, Tatematsu Y, Yamada H, Yanagisawa K, Tomida S, Yatabe...
  • 14
  • 331
  • 0
Mobility is a key predictor of change in well being among older adults who experience falls  evidence from the vancouver falls prevention clinic cohort

Mobility is a key predictor of change in well being among older adults who experience falls evidence from the vancouver falls prevention clinic cohort

Ngày tải lên : 25/08/2016, 22:07
... 2B5, Canada of Physical Therapy, 2177 Wesbrook Mall, University of British Columbia, Vancouver, British c Arthritis M AN U Columbia, V6T 2B5, Canada Research Centre of Canada, 5591 No Road, Richmond ... Brazier, J., Tsuchiya, A. , & Alava, M H (2011) Valuing states from multiple measures on the same visual analogue sale: a feasibility study Health Econ Sen, A. , & Nussbaum, M (1993) Capability and ... results Importantly, there are also limited longitudinal 316 ICECAP-O data published to date As such, we had limited data to compare our findings with Additional 317 longitudinal studies are needed...
  • 29
  • 342
  • 0
10236 test  group a  signal words in the present simple tense for intermediate level  25 questions  key is included  fully editable

10236 test group a signal words in the present simple tense for intermediate level 25 questions key is included fully editable

Ngày tải lên : 28/08/2016, 07:29
... Created by Susan V Toth The Solution 1) B 2) C 3) A 4) D 5) B 6) B 7) A 8) C 9) B 10) 11) 12) 13) 14) 15) 16) 17) 18) 19) 20) 21) 22) 23) 24) 25) D D C A C B C C D D C B A B C A ...
  • 3
  • 358
  • 0
Bài 1-Địa hình và khoáng sản Ch.Á ( có dùng film Flash)

Bài 1-Địa hình và khoáng sản Ch.Á ( có dùng film Flash)

Ngày tải lên : 14/09/2013, 21:10
... lãnh thổ Châu Nối ý cột A phù hợp với ý cột B A Đồng B Sông Tây Xi bia X a a- ri -a A-mu- a- ri -a Hoa bắc Trường giang Tu - ran Ô-bi ; I-ê-nit-xây Hoa trung Hoàng hà Nam Việt nam Mê- công •Học thuộc ... chảy qua đồng bằng? Qua tính chất thể dạng đ a hình , nhìn chung đ a hình Châu có đặc điểm bật ? •Có nhiều hệ thống núi cao nguyên cao đồ sộ giới, tập trung chủ yếu trung tâm lục đ a theo hai hướng ... màu Hình ảnh khai thác dầu khí Châu Á Đ a hình Châu Á bị cắt xẻ phức tạp : A B C D Có nhiều núi cao , sơn nguyên đồ sộ , thung lũng sâu rộng Núi cao nguyên cao đồ sộ chạy theo hai hướng , nhiều...
  • 15
  • 720
  • 1
Software Design and Development (A guide) is help you how to managed IT Project. Especially for Design and Develop software project.

Software Design and Development (A guide) is help you how to managed IT Project. Especially for Design and Develop software project.

Ngày tải lên : 15/10/2013, 23:13
... Initiation Phase Requirement Mission analysis stage Concept Dev Stage Development Phase System analysis stage System design stage Construct & acq stage User accept stage Operation and Maintenance ... Does the design conform to standards ? Day - Software Design Reviewing the design - finally Scrutinize the list of planned activities and test activities to ascertain whether any changes or additions ... Design includes an evaluation of the adequacy of the detailed technical requirements, an evaluation of the design choices, and a verification that the design satisfies all requirements and design...
  • 88
  • 649
  • 0
Tài liệu De-interlacing A Key Technology for Scan Rate Conversion doc

Tài liệu De-interlacing A Key Technology for Scan Rate Conversion doc

Ngày tải lên : 10/12/2013, 14:15
... part of the scanning format which is an integral part of the camera The desired anti-alias filtering is, therefore, required in the optical path in the camera This is rather difficult and expensive ... respectively and t the temporal position Recall that the analog video signal is a I-D continuous signal with the spatial position (~, ~)) mapped to the time t In order to obtain an amplitude and timediscrete ... motion analysis, and advanced image and video processing techniques The variety of topics on Image Communication is so large that no one can be a specialist in all the topics, and the whole area is...
  • 369
  • 428
  • 0
Tài liệu Helping Children When a Family Member Has Cancer ppt

Tài liệu Helping Children When a Family Member Has Cancer ppt

Ngày tải lên : 15/02/2014, 04:20
... This is not to say that talking about cancer is easy Here are some tips for talking to your children about a cancer diagnosis: Prepare what you want to say.  Many parents find it helpful to practice ... of charge to anyone facing a cancer diagnosis If you have found this resource helpful and wish to donate, please so online at www.cancercare.org/donate You may also send a check payable to CancerCare; ... not told the truth, they might imagine that things are worse than they really are or even that they themselves are the cause of the problem Talking to a child about a parent’s, grandparent’s,...
  • 24
  • 292
  • 0
Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

Ngày tải lên : 19/02/2014, 02:20
... primer and probe ⁄ 3fw TGGCCAGATCTAAAAAAGAGGT 2fw ATCCCAGGAAACACCAGTAGA 10rev ATTGTTTTCTCTCAAGACCCAA TaqMan probe T1 ACACCACAGCAAGGGAGAAGCAAAG 18Sfw CGCCGCTAGAGGTGAAATTC 18Srev TCTTGGCAAATGCTTTCGCT ... TGAAAATTGACATCGCTAGTCATATTCTACC-3¢ and its complement for His6Ala; 5¢-GACATCCATAGTGCT ATTCTACCAAAAGAATGGCC-3¢ and its complement for His8Ala (substituted nucleotides are underlined) pHILD2-ACMSD ... fw, forward; rev, reverse A B Sequence ACMSD cloning: primer 1fw CGCTCGAGATGAAAATTGACATCCATA GTCAT 11rev AAAGCTGAGCTCCATTCAAATTGTTTT CTCTCAAG 4fw TTCTCGAGATGGGAAAGTCTTCAGAGT GGT ACMSD real-time...
  • 14
  • 601
  • 0
Tài liệu Báo cáo khoa học: Novel aggregate formation of a frame-shift mutant protein of tissue-nonspecific alkaline phosphatase is ascribed to three cysteine residues in the C-terminal extension pdf

Tài liệu Báo cáo khoa học: Novel aggregate formation of a frame-shift mutant protein of tissue-nonspecific alkaline phosphatase is ascribed to three cysteine residues in the C-terminal extension pdf

Ngày tải lên : 19/02/2014, 17:20
... (ordinate, unit per mL fraction) BSA (b, 68 kDa), alcohol dehydrogenase (a, 141 kDa) and catalase (250 kDa) were loaded on to a separate gradient as molecular mass markers alkaline phosphatase (unit/mg ... 141 kDa) and catalase (c, 250 kDa) were loaded on to a separate gradient as molecular mass markers Not only the aggregate but also the covalently linked dimer almost disappeared (Fig 9A, lanes, ... 13 Ito M, Amizuka N, Ozawa H & Oda K (2002) Retention at the cis-Golgi and delayed degradation of tissuenon-specific alkaline phosphatase with an Asn153-Asp substitution, a cause of perinatal...
  • 14
  • 445
  • 0
Tài liệu Báo cáo khoa học: Hu-K4 is a ubiquitously expressed type 2 transmembrane protein associated with the endoplasmic reticulum ppt

Tài liệu Báo cáo khoa học: Hu-K4 is a ubiquitously expressed type 2 transmembrane protein associated with the endoplasmic reticulum ppt

Ngày tải lên : 19/02/2014, 17:20
... 4¢ 4¢ 5¢ A 105 75 50 35 + - + + Weak Weak > 54 aa aa T C C T G Weak Weak Adequate Weak Adequate aa 58 aa 13 aa 33 aa 31 aa Adequate Adequate aa 24 aa ATG ATG ATG ATG ATG C B αHu-K4 + PIS Peptide ... the plasma membrane or with the membranes of intracellular organelles although they lack a transmembrane domain They are attached to the cytoplasmic face of the membranes via palmitoyl anchors ... putative polyadenylation signals (AATAAG and AATAAC) are present about 20 nucleotides in front of the poly (A) tail (Fig 3A) Both are not identical to the most often used signal AAT AAA which is...
  • 9
  • 518
  • 0
Tài liệu Báo cáo khoa học: Local stability identification and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf

Tài liệu Báo cáo khoa học: Local stability identification and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf

Ngày tải lên : 20/02/2014, 01:20
... confirmed by DNA sequencing DNA sequencing Plasmid DNA was isolated with the GFXTM Micro Plasmid Prep Kit (Amersham Pharmacia Biotech, Piscataway, NJ, USA), and the resulting dsDNA was mixed with lL ... analytical grade chemicals such as EDTA, Tris ⁄ HCl, CaCl2, NaCl and mineral oil were obtained from Sigma (St Louis, MO, USA) Salmon testes DNA for the enzyme activity test was used without further ... that either the protein has poor stability or no secondary ⁄ tertiary structure results from either replacing the tryptophan at position 140 with alanine or the removal of a fragment from positions...
  • 7
  • 551
  • 0
Báo cáo khoa học: Nup358, a nucleoporin, functions as a key determinant of the nuclear pore complex structure remodeling during skeletal myogenesis docx

Báo cáo khoa học: Nup358, a nucleoporin, functions as a key determinant of the nuclear pore complex structure remodeling during skeletal myogenesis docx

Ngày tải lên : 06/03/2014, 01:20
... 5¢-GCAGCAUCUUUAAUGAAUAdTdT-3¢ and 5¢-AUAAGUAAUUUCUACGACG dTdT-3¢; Nup358, 5¢-CCAGUCACUUACAAUUAAAd TdT-3¢ and 5¢-UUUAAUUGUAAGUGACUGGdTdT-3¢ (siNup358-1), 5¢-UGAAGCACAUGCUAUAAAAdTdT-3¢ and 5¢-UUUUAUAGCAUGUGCUUCAdTdT-3¢ ... CCACCGCTTGAGAGACTTACTCTTGATTGTAACGA GGATA-3¢ and 5¢-AGCTTATCCTCGTTACAATCAA GAGTAAGTCTCTCAAGCGGTGGTAGCTGAAGAGG A- 3¢) were annealed and inserted into the BglII and HindIII sites of pEGFP-NLS The oligonucleotide ... diffraction-limited area AFM AFM was performed in contact mode with a Molecular Force Probe 3D (MFP-3D; Asylum Research, Santa Barbara, CA, USA) using a microcantilever OMCL TR-400 PSA (Olympus, Tokyo, Japan)...
  • 12
  • 454
  • 0
A Key Management Architecture for Digital Cinema ppt

A Key Management Architecture for Digital Cinema ppt

Ngày tải lên : 07/03/2014, 14:20
... cryptographic mechanisms SPBs shall carry an RSA private key [8] and a matching digital certificate stating their role, as to allow authentication by a Security Manager or another SPB After physical ... of actual content like image, audio or subtitle data, plus metadata A compliant track file is a self-contained instance that can be interpreted by a compliant decoder A track file starts with a ... interface and all the necessary key and order management features, while the actual KDM generation and security critical processes are performed with a separate software component running on another,...
  • 8
  • 491
  • 0
Báo cáo khoa học: Molecular cloning, expression and characterization of cDNA encoding cis-prenyltransferases from Hevea brasiliensis A key factor participating in natural rubber biosynthesis pdf

Báo cáo khoa học: Molecular cloning, expression and characterization of cDNA encoding cis-prenyltransferases from Hevea brasiliensis A key factor participating in natural rubber biosynthesis pdf

Ngày tải lên : 07/03/2014, 21:20
... (5¢-GCAAATGCAACTGGA AGCGG-3¢) and A1 (5¢-ACAGCCTGCTAGCAAAGA GG-3¢) for amplification of HRT1, and primers S2 (5¢-GAAGAATCCTCTAAGGATAA-3¢) and A2 (5¢-TA CAAGGATTAATCCCTTGC-3¢) for amplification ... (AAM92889, AAM92890), AAM92881, AAM92879, BAB92023 (AAM92883, AAM92884, AAM92885, AAM92887, AAM92888), BAB92024 and AAM92882 (AAM92886) (submitted to GenbankTM and DDBJ by Coldren et al and Sando et al ... rubber latex Phytochemistry 43, 769–772 Tangpakdee, J., Tanaka, Y., Ogura, K., Koyama, T., Wititsuwannakul, R., Wititsuwannakul, D & Asawatreratanakul, K (1997) Isopentenyl diphosphate isomerase and...
  • 10
  • 516
  • 0
Báo cáo khoa học: "A Rose is a Roos is a Ruusu: Querying Translations for Web Image Search" pdf

Báo cáo khoa học: "A Rose is a Roos is a Ruusu: Querying Translations for Web Image Search" pdf

Ngày tải lên : 08/03/2014, 01:20
... of the asserted translations may be incorrect – it additionally associates a probability score with each translation For our work we choose a probability threshold such that the overall precision ... translations to a set of high-coverage languages including English, French, German, Spanish, Chinese, Japanese, Arabic, Russian, Korean, Italian, and Portuguese Additionally, we include the language as well ... the search towards the intended sense This is probably because the additional words in the query (either from gloss or a random translation) confuse Google Images rather than focusing the search...
  • 4
  • 294
  • 0
Báo cáo khoa học: Studies on structure–function relationships of indolepyruvate decarboxylase from Enterobacter cloacae, a key enzyme of the indole acetic acid pathway ppt

Báo cáo khoa học: Studies on structure–function relationships of indolepyruvate decarboxylase from Enterobacter cloacae, a key enzyme of the indole acetic acid pathway ppt

Ngày tải lên : 08/03/2014, 02:20
... unpublished data) To obtain the forward scattering intensity I0 and the radius of gyration (RG) the data was processed with the program GNOMOKO [24] The molecular masses were calculated from the ratio ... EcIPDC, a discontinuous assay based on HPLC was used [7] To analyse the kinetic behaviour of the enzyme in more detail, a coupled optical assay was elaborated with alcohol dehydrogenase as auxiliary ... calibrated using collagen or tripalmitin as standards The scattering patterns were collected in 15 frames of to verify the absence of radiation damage The experimental data was normalized to the...
  • 10
  • 430
  • 0