what skills and competencies would be required of a software project manager

The Duality of Memory and Communication in the Implementation of a Multiprocessor Operating System

The Duality of Memory and Communication in the Implementation of a Multiprocessor Operating System

Ngày tải lên : 12/09/2012, 15:05
... in nature to a data manager which fails to free data, but is easier to detect and prevent. ã Data manager changes data. A malicious data manager may change the value of its data on each cache refresh. ... copy-on-reference of process data. The interaction of message and memory primitives can also be an important tool in the design and implementation of transaction and database management facilities. Work is also ... the cached data. The kernel uses the pager_data_write call in response, just as when it initiates a cache replacement. A data manager may restrict the use of cached data by issuing a pager_data_lock...
  • 23
  • 1.3K
  • 1
Tài liệu Báo cáo " synthesis, cloning and expression in escherichia coli of a gene coding for Mcoti-ii " ppt

Tài liệu Báo cáo " synthesis, cloning and expression in escherichia coli of a gene coding for Mcoti-ii " ppt

Ngày tải lên : 12/02/2014, 10:20
... cttggggcct ctaaacgggt cttgaggggt 360 361 TTTTTGCTGA AAGGAGGAAC TATATCCGGA TATCCCGCAA 400 401 GAGCCCGGCA GTACCGGCAT AACCAAGCCT ATGCCTACAG 440 441 CATCCAGGGT TTG GACGGTGCCG AGGATGACGA TGAAGCGCCA 480 ... 41 ttattatggg tattacttta tctgatgatt ctgaTcatca 80 81 Gtttttgctt ggatcccagg ttgttgtaca gaatgctggt 120 121 catatgagcg gcagcgatgg cggcgtgtgc cgaaaattct 160 161 gaaaaaatgc cgccgcgata gcgattgccc ... gggcgcgtca 200 201 tttgccgcgg caacggctat tgcggctaac tcgagcccgg 240 241 gtgactgcag gaaggggatc cggctgctaa caaagcccga 280 281 aaggaagctg agttggctgc tgccaccgct gagcaataac 320 321 tagcataccc cttggggcct...
  • 9
  • 497
  • 0
Tài liệu The Banker and the Bear The Story of a Corner in Lard ppt

Tài liệu The Banker and the Bear The Story of a Corner in Lard ppt

Ngày tải lên : 17/02/2014, 19:20
... with the markets before; that was the reason he now needed a job as assistant cashier, or as anything that would pay him a respectable salary. But he had been an outsider, a lamb. He had believed ... them, or at least make them a long visit. Somewhat to Dick's surprise she accepted; partly because the idea of having any sort of a home appealed to her, and partly because, in spite of her ... "I'm going to visit the Bagsburys. I don't know how long I'll stay; it may be a month, and it may be a year, and I may find a home there. But I shall miss you all dreadfully, and...
  • 120
  • 701
  • 0
Báo cáo khoa học: Structure and potential C-terminal dimerization of a recombinant mutant of surfactant-associated protein C in chloroform/methanol ppt

Báo cáo khoa học: Structure and potential C-terminal dimerization of a recombinant mutant of surfactant-associated protein C in chloroform/methanol ppt

Ngày tải lên : 16/03/2014, 16:20
... peak integration unreliable. So, instead, signal height of the cross-peaks was used for a conservative estimation of the maximum distances and classification of cross-peaks as weak, medium and strong. ... calibration of the intensities of the NOE peaks, a statistical analysis of the d aN (i,i+3) signals of residues 11–30 was performed using typical values for an ideal a- helix [13]. The a- helical structure ... Germany; 3 Department of Physical Organic Chemistry and 4 Department of Chemical Research, Altana Pharma AG, Konstanz, Germany; 5 Max Planck Institut fu ă r Biophysikalische Chemie, Go ă ttingen, Germany The...
  • 10
  • 426
  • 0
Family Life, Reproductive Health, and Population Education: Key Elements of a Health-Promoting School docx

Family Life, Reproductive Health, and Population Education: Key Elements of a Health-Promoting School docx

Ngày tải lên : 22/03/2014, 12:20
... qualitative data including anecdotal informa- tion, and quantitative (numeric) data on needs and resources inside and outside of school that will be used for planning interventions and as a baseline ... Health Team and Community Advisory Committee are established, members can start the planning process by conducting a situation analysis. It is important to make the analysis manageable and practical ... relationships Adolescents: ã To clarify what level of intimacy might be appropriate for which kind of relationships and to reinforce one’s right to set limits ã To understand what enhances and what damages a relationship Figure...
  • 90
  • 469
  • 0
Báo cáo khoa học: Functional characterization and Me2+ ion specificity of a Ca2+–citrate transporter from Enterococcus faecalis1 pdf

Báo cáo khoa học: Functional characterization and Me2+ ion specificity of a Ca2+–citrate transporter from Enterococcus faecalis1 pdf

Ngày tải lên : 23/03/2014, 10:20
... Microbiologı ´ a, Facultad de Ciencias Bioquı ´ micas y Farmace ´ uticas, Universidad Nacional de Rosario, Argentina Analysis of a large set of bacterial genomes has shown that, in spite of its high abundance ... (2004) Characterization of an oxaloacetate decarboxylase that belongs to the malic enzyme family. FEBS Lett 570, 217–222. V. S. Blancato et al. Ca 2+ –citrate transporter of E. faecalis FEBS Journal ... are on a separate branch of the tree that is well separated from other branches (Fig. 1). The transporters of Lactobacillus species casei and sakei, which are on the same branch, are also associated...
  • 10
  • 386
  • 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Ngày tải lên : 23/03/2014, 13:20
... CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC JH4-5.link CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC JH6.link CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCGTGGTCCC L. ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC VK5.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC VK6.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC VL1.link ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTTCTTCTGAGCTGACTCAGGACCC VL 3a. link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTTCCTATGTGCTGACTCAGCCACC VL4.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCACGTTATACTGACTCAACCGCC VL5.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGGCTGTGCTCACTCAGCCGTC VL6.link...
  • 11
  • 679
  • 0
báo cáo hóa học: "Ambulatory measurement of knee motion and physical activity: preliminary evaluation of a smart activity monitor" pdf

báo cáo hóa học: "Ambulatory measurement of knee motion and physical activity: preliminary evaluation of a smart activity monitor" pdf

Ngày tải lên : 19/06/2014, 10:20
... broker transported cli- ents by car to view residential property. Data Analysis Data were processed and analyzed after testing each sub- ject. The same time interval of BML and IDEEA data was analyzed ... in analyzing the data and revis- ing the manuscript. All authors read and approved the final manuscript. Acknowledgements The authors thank Patrick Duplessis for his assistance with data analysis. ... for citation purposes) Journal of NeuroEngineering and Rehabilitation Open Access Research Ambulatory measurement of knee motion and physical activity: preliminary evaluation of a smart activity...
  • 10
  • 378
  • 0
báo cáo hóa học:" Ovarian cancer plasticity and epigenomics in the acquisition of a stem-like phenotype" pptx

báo cáo hóa học:" Ovarian cancer plasticity and epigenomics in the acquisition of a stem-like phenotype" pptx

Ngày tải lên : 20/06/2014, 07:20
... Mitra AK, Radjabi AR, Bhaskar V, Kistner EO, Tretiakova M, Jagadeeswaran S, Montag A, Becker A, Kenny HA, Peter ME, Ram- akrishnan V, Yamada SD, Lengyel E: Loss of E-cadherin promotes ovarian cancer ... purposes) Journal of Ovarian Research Open Access Review Ovarian cancer plasticity and epigenomics in the acquisition of a stem-like phenotype Nicholas B Berry and Sharmila A Bapat* Address: National Centre ... 190:125-133. 58. Ahluwalia A, Yan P, Hurteau JA, Bigsby RM, Jung SH, Huang TH, Nephew KP: DNA methylation and ovarian cancer. I. Analysis of CpG island hypermethylation in human ovarian cancer using...
  • 11
  • 555
  • 0
báo cáo hóa học:" Does self-regulation and autonomic regulation have an influence on survival in breast and colon carcinoma patients? results of a prospective outcome study" potx

báo cáo hóa học:" Does self-regulation and autonomic regulation have an influence on survival in breast and colon carcinoma patients? results of a prospective outcome study" potx

Ngày tải lên : 20/06/2014, 15:20
... ‘change behaviour to reach a goal’ and 2) a subscale called ‘Achieve satis- faction and well-being’ [20]. The aim of our study was to assess the influence on overall survival of 1) the validated autonomic ... high operation rate and mistletoe basel ine application rate and the small sample size (compare table 1). Colorectal cancer patients have in comparable stages with breast cancer patients an inferior ... [46] and in face of contradictory results fatigue, p hysical and emotional functioning in breast cancer and global h ealth and particularly social functioning in colorectal cancer could be prognostic indictors...
  • 11
  • 538
  • 0
Tài liệu Improving Child Health in Cambodia: Social Marketing of Diarrhea Treatment Kit, Results of a Pilot Project pdf

Tài liệu Improving Child Health in Cambodia: Social Marketing of Diarrhea Treatment Kit, Results of a Pilot Project pdf

Ngày tải lên : 12/02/2014, 19:20
... in rural areas of Siem Reap and Pursat. The partnerships also facilitated an extensive training program of partners and providers on diarrheal disease, pre- vention, and treatment, and the ... challenges faced by Cambodian moth- ers and caregivers in the day to day care of their children and treating diarrhea. The docudrama covered a range of sanitation and hygiene issues including causes, ... 12 www.casesjournal.org To increase acceptability of the product, messages also emphasized the fact that the Orasel tasted better than the available ORS and that the zinc had a sweet taste. Village...
  • 19
  • 438
  • 1