what kinds of energy can be used now a day

Báo cáo y học: " Initial distribution volume of glucose can be approximated using a conventional glucose analyzer in the intensive care unit" pot

Báo cáo y học: " Initial distribution volume of glucose can be approximated using a conventional glucose analyzer in the intensive care unit" pot

Ngày tải lên : 12/08/2014, 20:21
... haemodiafiltration Values are presented as mean ± standard deviation (range) or as number of patients aCatecholamines: an infusion of dopamine, dobutamine, noradrenaline, or adrenaline bInsulin: ... 1.83 l and the rate of disappearance of glucose from plasma was 0.069 ± 0.018 Bland–Altman plots of the differences between each approximated IDVG and original IDVG are shown in Fig There was a close ... that approximated IDVG is clinically relevant because it may be used for point -of- care testing to assess fluid volume Key messages • • IDVG has been proposed to be an indirect measure of cardiac...
  • 6
  • 286
  • 0
Báo cáo lâm nghiệp: "Can sales of infested timber be used to quantify attacks by Ips typographus (Coleoptera, Scolytidae)? A pilot study from Belgium" ppt

Báo cáo lâm nghiệp: "Can sales of infested timber be used to quantify attacks by Ips typographus (Coleoptera, Scolytidae)? A pilot study from Belgium" ppt

Ngày tải lên : 08/08/2014, 01:22
... was made using criteria such as the tree species, the quality of timber and the silvicultural operation 2.2 Data evaluation In order to test the reliability of the data, an evaluation was carried ... flight season – the beetles had already flown away – and in (16%) of the sites, trees had been attacked a year or more earlier (Tab II) The questionnaire, interviews and field verifications yielded ... overestimated, 480 A Franklin et al as more trees are cut than are actually infested The reliability of data could probably be improved if standard rules for recording infestations are established Foresters...
  • 4
  • 324
  • 0
báo cáo khoa học: " Can the ubiquitous power of mobile phones be used to improve health outcomes in developing countries" pps

báo cáo khoa học: " Can the ubiquitous power of mobile phones be used to improve health outcomes in developing countries" pps

Ngày tải lên : 11/08/2014, 18:20
... Hypertension United States Hospice patients Scotland Asthma United States Smoking cessation Croatia Asthma Spain Cardiovascula r disease Finland Diabetes Spain Vaccination rates Hepatitis A and B Whether ... thirds of the requested diary data [28] "The combination of SMS data collection and a traditional Web page for data display and system customization may be a better and more usable tool for patients ... of a certain time period per month for a year Potential customers have to provide proof of a regular income, sign a contract, and have a bank account and a permanent address Since the vast majority...
  • 14
  • 401
  • 0
Báo cáo y học: "Can HRCT be used as a marker of airway remodelling in children with difficult asthma?" docx

Báo cáo y học: "Can HRCT be used as a marker of airway remodelling in children with difficult asthma?" docx

Ngày tải lên : 12/08/2014, 16:20
... from asthmatics [7] HRCT scans were loaded to a PACS workstation (mv1000, Siemens) and all images were analysed electronically A magnification factor of was applied in all images that were displayed ... Kasahara K, Shiba K, Ozawa T, Okuda K, Adachi M: Correlation between the bronchial subepithelial layer and whole airway wall thickness in patients with asthma Thorax 2002, 57:242-246 Little SA, ... measurements PKJ was involved in biopsy preparation and 19 20 Barbato A, Turato G, Baraldo S, Bazzan E, Calabrese F, Tura M, Zuin R, Beghe B, Maestrelli P, Fabbri LM, Saetta M: Airway inflammation in...
  • 9
  • 390
  • 0
Báo cáo hóa học: " Could sound be used as a strategy for reducing symptoms of perceived motion sickness?" docx

Báo cáo hóa học: " Could sound be used as a strategy for reducing symptoms of perceived motion sickness?" docx

Ngày tải lên : 19/06/2014, 08:20
... JD also participated in the analysis of the results and preparation of the manuscript AS participated in the experimental trials, were responsible for the statistical analysis and participated ... thick foam plate Results indicate that audio biofeedback significantly reduces body sway in healthy subjects and can be used to treat postural instability by helping the brain to maintain posture ... psychophysiological responses, the imbalance between the sympathetic and parasympathetic nervous system that normally occurs before the subject is aware of any change in wellbeing can be observed The reason...
  • 9
  • 609
  • 0
Game on: How  gaming can be used to make my product more engaging

Game on: How gaming can be used to make my product more engaging

Ngày tải lên : 03/07/2014, 14:47
... engaging? DESIGNER I can t wait for the next great gaming experience! GAMER ARe YOU MOBILE ARe YOU CASUAL ARe YOU AVID How can I use gaming to make my product more engaging? DESIGNER (or anyone ... http://en.wikipedia.org/wiki/Hype_cycle http://meta.gamify.com/ How I make boring stuff fun? FLASH HTML5 gamification SEO SOCIAL WEB 2.0 gamification “the use of game play mechanics for non-game applications, ... social relationships, 3) a bigger sense of purpose and 4) meaningful mastery - Jane McGonigal gamification extrinsic motivators intrinsic motivators “extrinsic motivators may lead “People are best...
  • 172
  • 366
  • 0
Báo cáo " WHAT CAN HISTORY TEACH US? A Retrospective Examination of Long-Term Energy Forecasts for the United States " pptx

Báo cáo " WHAT CAN HISTORY TEACH US? A Retrospective Examination of Long-Term Energy Forecasts for the United States " pptx

Ngày tải lên : 24/03/2014, 01:21
... transparency of models cannot be overestimated A model that the audience can actually grasp is inherently more persuasive than a black box that no one outside of a small circle of analysts understands ... primary reliance on nuclear power and favored greater emphasis on renewables such as solar and biomass Each participant was asked to rate each study from the perspective of analytical strength, attention ... estimates of energy use were below those of almost all other forecasts and turned out to have been remarkably accurate His goal was to make the case that technical advances would allow the nation...
  • 38
  • 449
  • 0
Khắc phục lỗi “Your profile can not be used because it is from a newer version of Google Chrome” ppsx

Khắc phục lỗi “Your profile can not be used because it is from a newer version of Google Chrome” ppsx

Ngày tải lên : 12/07/2014, 16:20
... Trong viết sau, thảo luận cách khắc phục vấn đề Mở Windows Explorer chuyển tới đường dẫn: C:UsersYOURUSERNAMEAppDataLocalGoogleChromeU ser DataDefault (thay YOURUSERNAME với tên tài khoản ... hidden, files folder and drives): Tìm đến file web data x a file này: Lưu ý không thực chắn làm thao tác này, đổi tên file thành web data.bk Sau khởi động Google Chrome, bạn thấy thông báo lỗi ... thống): Chuyển sang chế độ hiển thị tất file ẩn hệ thống mục Folder Options (Start > Folder Options > Folder Options > View > Hidden files and folders > Show hidden, files folder and drives): Tìm...
  • 5
  • 548
  • 0
Báo cáo lâm nghiệp: "Infrared images of heat fields around a linear heater in tree trunks: what can be learned about sap flow measuremen" pptx

Báo cáo lâm nghiệp: "Infrared images of heat fields around a linear heater in tree trunks: what can be learned about sap flow measuremen" pptx

Ngày tải lên : 07/08/2014, 16:20
... from an elongated ellipse to a contracted one approaching a circle What can be learned from the analysis of such ellipses? 3.2.1 Evaluation of sap flow from infrared heat field images There are basically ... horizontally displaced from the heating needle is needed as well as a temperature sensor array along the axis Infrared images of heat field and sap flow 659 Since p and z are measured distances, a can ... axial direction, and an asymmetrical one with the upper end of the thermocouple placed at the same axial height as the heater and a lower reference, placed at a certain distance below the heater...
  • 8
  • 377
  • 0
báo cáo khoa học: " A review of health system infection control measures in developing countries: what can be learned to reduce maternal mortality" pps

báo cáo khoa học: " A review of health system infection control measures in developing countries: what can be learned to reduce maternal mortality" pps

Ngày tải lên : 11/08/2014, 14:21
... interventions American Journal of Infection Control 2002, 30:145-152 49 Kothari A, Sagar V, Ahluwalia V, Pillai BS, Madan M: Costs associated with hospital-acquired bacteraemia in an Indian hospital: a case-control ... Welfare 1997, 43:1-4 13 Rajaram P, Agrawal A, Swain S: Determinants of maternal mortality: a hospital-based study from South India Indian Journal of Maternal and Child Health 1995, 6:7-10 14 Belizán ... JM, Althabe F, Barros FC, Alexander S: Rates and implications of caesarean sections in Latin America: ecological study BMJ 1999, 319(7222):1397 15 Villar J, Valladares E, Wojdyla D, Zavaleta N,...
  • 9
  • 551
  • 0
Báo cáo y học: "Malaria control in Timor-Leste during a period of political instability: what lessons can be learned" docx

Báo cáo y học: "Malaria control in Timor-Leste during a period of political instability: what lessons can be learned" docx

Ngày tải lên : 13/08/2014, 13:21
... comments on an earlier draft Malaria Unit staff: the late Dr Fernando Bonaparte, Dr Milena Lay, Maria Mota and Johaness Don Bosco were generous in facilitating access and supplying malaria data Likewise, ... prescribed the use of RDT and ACT in malaria control in Timor-Leste ACT has been shown to be effective in treating drug-resistant falciparum and vivax malaria in Papua, Indonesia [27] It has been used ... planning and undertaking this work; Avelino Guterres, Kayli Wayte, Paula Gleeson, Natalie Grove, David Traynor, Anna Whelan, Derrick Silove, Daniel Tarantola, and Luis Cardoso Elizabeth Adams and...
  • 10
  • 292
  • 0
Strategic environmental assessments may be used to compare different energy scenarios, and a more sustainable power plan can be developed by incorporating the wider impacts considered during the assessment process

Strategic environmental assessments may be used to compare different energy scenarios, and a more sustainable power plan can be developed by incorporating the wider impacts considered during the assessment process

Ngày tải lên : 08/09/2015, 23:32
... lignite and coal capacity under the global impacts case and of GW of large hydropower capacity (22 plants), GW of nuclear capacity, and GW of lignite and coal capacity under the regional impacts case ... Cambodia and the Lao PDR are weighted averages of those for Thailand and Viet Nam The additional renewable energy capacity in the renewable energy scenario allows the displacement of GW of lignite and ... sustainability of the power plans at a comparatively low additional financial cost Moreover, energy efficiency measures can offset costs of additional renewable energy From an energy planning as well as...
  • 50
  • 456
  • 0
EU ANTI-DUMPING LAWSUIT AGAINST VIETNAM - WHAT CAN BE LEARNT FROM THE FOOTWEAR CASE

EU ANTI-DUMPING LAWSUIT AGAINST VIETNAM - WHAT CAN BE LEARNT FROM THE FOOTWEAR CASE

Ngày tải lên : 04/04/2013, 16:17
... comparison: - A comparison of a weighted average normal value with a weighted average of prices of all comparable export transactions - A comparison of normal value and export prices on a transaction-to-transaction ... might prevail Any non-market economy country which Albania, is a member of the WTO at the date of the Azerbaijan, initiation of the investigation Le Thanh Hai - A4 - BBE - K41 Armenia, Georgia, Kyrgyzstan, ... price and the normal value in the EU's law is the same as the WTO's It must be fair, specific, shall be made at the same level of trade and in respect of sales made at as nearly as possible the same...
  • 66
  • 538
  • 4
EU ANTI-DUMPING LAWSUIT AGAINST VIETNAM - WHAT CAN BE LEARNT FROM THE FOOTWEAR CASE?

EU ANTI-DUMPING LAWSUIT AGAINST VIETNAM - WHAT CAN BE LEARNT FROM THE FOOTWEAR CASE?

Ngày tải lên : 27/07/2013, 08:50
... average of prices of all comparable export transactions - A comparison of normal value and export prices on a transaction-totransaction basis - a weighted average basis may be compared to prices of ... prevail Any non-market economy country Albania, Armenia, which is a member of the WTO at the Azerbaijan, Georgia, date of the initiation of the investigation Kyrgyzstan, Moldova and Mongolia Other ... the same as the WTO's It must be fair, specific, shall be made at the same level of trade and in respect of sales made at as nearly as possible the same time and with due account taken of other...
  • 84
  • 544
  • 0
What can be done

What can be done

Ngày tải lên : 01/11/2013, 09:20
... deal of language awareness, as well as social solidarity, results from the various forms of extra-curricular activity which a community can arrange as part of its language maintenance programme ... may take a lot of time and money to obtain a small amount of data, whose range and quality may fall well short of what is usually found in academic studies, such as a thesis or journal publication ... of freedom of Native Americans to use, practice and develop Native American languages’, the second ‘to assist Native Americans in assuring the survival and continuing vitality of their languages’.17...
  • 40
  • 436
  • 0
Why do Internet services fail, and what can be done about it? ppt

Why do Internet services fail, and what can be done about it? ppt

Ngày tải lên : 06/03/2014, 21:20
... and better-tested application software at that service, fewer changes made to the service on a day- to -day basis, and a higher degree of node redundancy than is used at Online and Content Table ... example, was reimaging the backup machine after the primary had failed really an operator error, if the operator was unaware that the primary had failed? Was intentionally leaving the tape backup ... primary copy of the problem tracking database had been destroyed, and that the machine he or she was about to reimage held the backup copy of that database Understanding how a system will be affected...
  • 15
  • 387
  • 0
Báo cáo khoa học: The propagation of hamster-adapted scrapie PrPSc can be enhanced by reduced pyridine nucleotide in vitro pdf

Báo cáo khoa học: The propagation of hamster-adapted scrapie PrPSc can be enhanced by reduced pyridine nucleotide in vitro pdf

Ngày tải lên : 07/03/2014, 03:20
... maintains a stable propagating capacity in normal brain homogenates after NADPH is removed Because the increased level of NADPH-diaphorase may correlate with the active synthesis of NADPH, one may think ... conversion of PrPC into PrPSc with PMCA in vitro To test whether NADPH-related enhancement was also appropriate to another scrapie agent, hamsteradapted scrapie strain 13 9A (SHa-13 9A) was used in PMCA ... transferring electrons, the energy class of PrP may change, leading to an unstable status Another aspect may be the potential metal-catalysed oxidation of PrP Reduced Cu+ from Cu2+ by NADPH can...
  • 10
  • 342
  • 0
Báo cáo khoa học: Tyrosine-dependent basolateral targeting of human connexin43–eYFP in Madin–Darby canine kidney cells can be disrupted by the oculodentodigital dysplasia mutation L90V ppt

Báo cáo khoa học: Tyrosine-dependent basolateral targeting of human connexin43–eYFP in Madin–Darby canine kidney cells can be disrupted by the oculodentodigital dysplasia mutation L90V ppt

Ngày tải lên : 23/03/2014, 04:20
... LSYTRF, 5Â-GCAAG AAGAATTGTTTCTGTCGCCAGTGAACCGGGTATAT GACAAAGGAGACATAGGCGAGAGGGGAGC-3Â The complementary sequences were used as reverse primers Subcloning of Cx43eYFP constructs into BH-RCAS and pLPCX ... the American Brain Tumor Association Michael Reiss Fellowship (A. L.), Art of the Brain (A. L.), unrestricted funds from the Cancer Center of Santa Barbara (A. L.), and National Institutes of Health ... apical and basolateral compartments of the culture dishes The MDCK cell monolayer provides a barrier between the apical and basolateral compartments The voltage drop over the membrane was measured...
  • 14
  • 433
  • 0
báo cáo hóa học:" Can Urine Lamivudine Be Used to Monitor Antiretroviral Treatment Adherence?" doc

báo cáo hóa học:" Can Urine Lamivudine Be Used to Monitor Antiretroviral Treatment Adherence?" doc

Ngày tải lên : 20/06/2014, 08:20
... relationships Vasanthapuram Kumaraswami, MD, PhD, has disclosed no relevant financial relationships Soumya Swaminathan, MD, DNB, has disclosed no relevant financial relationships The authors gratefully ... of the various standards used for constructing calibration graphs for urine 3TC are given in Table The intraday and interday relative standard deviation (RSD) for standards 2.550.0 mcg/mL ranged ... Cotati, California) attached with a 20-microliter (mcL) sample loop was used for loading the sample ClassVP-LC workstation was used for data collection and acquisition The analytic column was a...
  • 6
  • 318
  • 0
How to be a good steward of energy and the environment potx

How to be a good steward of energy and the environment potx

Ngày tải lên : 29/06/2014, 04:20
... Because we don’t need it There are already lots of alternatives that we can easily use instead D Because its increasing price would make the use of oil uneconomical long before we ever used all ... reality And they it far better than any nannystate regulation This isn’t happening now because for most uses, oil is still the best and cheapest source of energy available Creating Resources The fear ... Potential Alaska ANWR CANADA This circle is the size of This circle is the size The the entire Arctic National of Alaska Arctic Wildlife Refuge, or ANWR (365 UNITED National (19 million acres)...
  • 15
  • 462
  • 0