what kind of modern uniform is worn at dt university today

clothing

clothing

Ngày tải lên : 20/10/2014, 04:00
... Wedding dress What are they? a Rings b Necklace c Bracelet d Ear ring 10 What are they? a Waterproof b Tailcoat c T-shirts d coat 11 What they wear? a Vest b Overcoat c Parka d shirt 12 What does she ... What is this? a Boot b Clog c Bootee d Brogue What kind of shoe used when staying t home? a Patten b Pump c Slipper d sandal What are they? a.Court shoe b.Galosh c.Mule d.slipper What is she wearing ... Look at this picture! How many “crystal necklace” the pictures have? a b c d 20 What we call this? a b c d Clock Gauge Time Watch Prepared by: Nguyen Thi Kim Kieu Class: English 2006 B What is...
  • 131
  • 447
  • 0
What kind of advice should you listen to? building a desire engine pdf

What kind of advice should you listen to? building a desire engine pdf

Ngày tải lên : 28/06/2014, 17:20
... Examples External Alarms Advertising Calls-to-action Emails Stores Emotions Routines Situations Places People What to next is in the trigger @nireyal Internal What to next is in the user’s head NirAndFar.com ... NirAndFar.com Habits aren’t created, they are built upon @nireyal NirAndFar.com External trigger • • Formulate consistent calls-to-action Each embedded answer to what is this for?” supporting the internal ... Internal trigger • What is the existing behavior you’re attaching to? • • When would user engage? Know the narrative “Every time you (verb), use ” @nireyal NirAndFar.com Negative emotions are...
  • 82
  • 313
  • 0
also, what kind of trade policy do you think should the government adopt for the benefit of the country as whole

also, what kind of trade policy do you think should the government adopt for the benefit of the country as whole

Ngày tải lên : 12/07/2014, 14:18
... FRAMEWORK What is producer ? In Social studies PRODUCER In Science Company Proprietary and Confidential Company Proprietary and Confidential Part I: THE FRAMEWORK What is consumer ? • The consumer is ... Confidential Company Proprietary and Confidential 19 WHAT KIND OF TRADE POLICY GOVERNMENT SHOULD ADOPT • Maximize one’s benefit at the condition that the other one’s lest loss, in order to get overall ... theory of national competitive advantage Company Proprietary and Confidential Company Proprietary and Confidential Part I: THE FRAMEWORK Trade theory • The theories of international trade also matter...
  • 20
  • 1.3K
  • 0
What kind of energy

What kind of energy

Ngày tải lên : 10/06/2016, 16:18
  • 2
  • 443
  • 0
Báo cáo khoa học: "WHAT A TYPE OF INTERACTION IS IT TOBE HT" potx

Báo cáo khoa học: "WHAT A TYPE OF INTERACTION IS IT TOBE HT" potx

Ngày tải lên : 24/03/2014, 01:21
... these notes, we are at a very general tevel of discourse The real pay-offs, however, w i l l come from discussing specifics For t h a t , i n t e r a c t i o n w i l l be needed, rather than position...
  • 2
  • 301
  • 0
Metaphor, based on the association of similarity, is one of the two basic types of semantic transference that have been an interest for many linguistic researchers

Metaphor, based on the association of similarity, is one of the two basic types of semantic transference that have been an interest for many linguistic researchers

Ngày tải lên : 07/11/2012, 14:44
... 12) in terms of the variables of Field, Tenor and Mode + The FIELD OF DISCOURSE concerns what is happening, to the nature of the social action that is taking place: what is it that the participants ... situation types and it is the characteristics of this situation type that influence the forms of language that realize the genre So the context of situation (register) is the second aspect of ... The MODE OF DISCOURSE concerns what part the language is playing, what it is that the participants are expecting the language to for them in that situation, the symbolic organisation of the text,...
  • 53
  • 1K
  • 3
Tài liệu Tiếng Anh lớp 1, 2 - Lesson fourteen (Bài 14) Is he...? - Is she...? - Is it...? ppt

Tài liệu Tiếng Anh lớp 1, 2 - Lesson fourteen (Bài 14) Is he...? - Is she...? - Is it...? ppt

Ngày tải lên : 21/01/2014, 15:20
... thiết) - Is he .? - , he is - Is she ? - , she is not - Is it .? - , it is - Is he .? - , he is not - Is she ? - , she is - Is it .? - , it is not - Is he ... Việt: - Is it open? - Yes, it is - Is he unhappy? - No, he is not - Is she clever? - Yes, she is - Is it close? - No, it is not - Is he tired? - Yes, he is - Is she stupid? - No, she is not - Is it ... Is he .? - , he is - Is she ? - , she is not - Is it .? - , it is - Is it .? - , it is not - Is it .? - , it is - Is it .? - , it is not Bước 4: Đọc câu...
  • 7
  • 410
  • 2
Tài liệu The 2012 Nexus Event – An Unknown Form Of Energy Is Coming Our Way pdf

Tài liệu The 2012 Nexus Event – An Unknown Form Of Energy Is Coming Our Way pdf

Ngày tải lên : 19/02/2014, 03:20
... is been collecting since the birth of the galaxy This is where we can easily seen the location of the galactic plane, which is in fact what the modern science calls a galactic equinox But what ... that you can tell what is in the Ice With the Beryllium10 the radioactive isotope of Beryllium that’s created in the atmosphere when the atmosphere is bombarded with cosmic rays and to separate ... hemisphere – Sagittarius and it points or is shooting directly into the galactic center! Way…this is heavy information, if you are aware what is coming in 2012 When you analyze what is illustrating...
  • 329
  • 684
  • 0
Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx

Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx

Ngày tải lên : 19/02/2014, 05:20
... ATTTCATCTAATACAGTC GCGGGATCCACGATGTCTCACACCATTTTGC GCGGAATTCTTATTTCCCAGCCTGTTGGGCCTG CTTCTGGCTGCCTCACTCC GCGCGATATCGCAAGATGGCGGACATCTCCCTGG CTCAAAGCTTGATTTTGAATTCTGTG CTTCTGGCTGCCTCACTCC GCGCGATATCGCAAGATGGCGGACATCTCCCTGG ... ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT GCGGGATCCCAGCCCATCCTGCTGCGGCTG ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT GCGGGATCCCAGCCCATCCTGCTGCGGCTG ATAAGAATGCGGCCGCTCAGGGCTGCGTGGTCACAGAGGC GCGGGATCCCGCAGGGTGAACTCTGCCTCC ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT ... GCGGGATCCCGCAGGGTGAACTCTGCCTCC ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT GCGGGATCCCCCCCTGCCGAAGTGGACCCT ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT pCR2.1...
  • 14
  • 517
  • 0
Tài liệu The future of cinema is smooth, crisp and amazing docx

Tài liệu The future of cinema is smooth, crisp and amazing docx

Ngày tải lên : 19/02/2014, 10:20
... technology limitations may also affect that business While the clarity, color, and image quality people see at the movie theater exceeds that of their home televisions, the sensation of fast-action ... path that keeps our exhibitor customers one step ahead of where the motion picture industry is going For more information on Christie Solaria Series software upgrades, the Christie IMB, Christie’s ... jerkiness that’s just become a part of conventional filmmaking is visually accentuated in 3D, because watching eyes are working particularly hard to focus on moving objects Christie is leading...
  • 8
  • 639
  • 0
Báo cáo Y học: Regulation of RAS in human platelets Evidence that activation of RAS is not sufficient to lead to ERK1-2 phosphorylation pot

Báo cáo Y học: Regulation of RAS in human platelets Evidence that activation of RAS is not sufficient to lead to ERK1-2 phosphorylation pot

Ngày tải lên : 08/03/2014, 16:20
... This is consistent with the observation that TPO, which is unable to induce activation of PKC, does not stimulate activation of ERK in platelets This result indicates that activation of RAS is ... kinases and suggest that activation of RAS is dispensable for efficient activation of ERK DISCUSSION Activation of RAS was evaluated in platelets through the ability of the activated RAS–GTP to bind ... This is consistent with previous reports demonstrating that ERK regulation is mediated downstream of PKC [7] In contrast, activation of RAS by thrombin and convulxin was not affected by treatment...
  • 7
  • 436
  • 0
Báo cáo khoa học: "MACHINE TRANSLATION : WHAT TYPE OF POST-EDITING ON WHAT TYPE OF DOCUMENTSFOR WHAT TYPE OF USERS" pdf

Báo cáo khoa học: "MACHINE TRANSLATION : WHAT TYPE OF POST-EDITING ON WHAT TYPE OF DOCUMENTSFOR WHAT TYPE OF USERS" pdf

Ngày tải lên : 08/03/2014, 18:20
... reading of the documents to be translated on the basis of these features, and according to the relative frequence of one category of probable errors or the other, one could then easily evaluate if ... neutrality of a computerized system is quite fitted to that situation And the minimal post-editing creates often the best style The users' satisfaction should be the ultimate criterion to evaluate the ... chief of a translation division to choose which texts were to be sent to a human translator, and which could be processed by M.T But at the same time the variety of documents machine trabslated is...
  • 3
  • 359
  • 0
Báo cáo Y học: High affinity binding between laminin and laminin binding protein of Leishmania is stimulated by zinc and may involve laminin zinc-finger like sequences doc

Báo cáo Y học: High affinity binding between laminin and laminin binding protein of Leishmania is stimulated by zinc and may involve laminin zinc-finger like sequences doc

Ngày tải lên : 08/03/2014, 23:20
... uncoated beads (lane 1) In order to know whether clustering of LBP by anti-LBP Ig also Adhesion of pathogen to host tissue is a prerequisite for many types of infections Diseases such as leishmaniases ... of laminin with biological activity [21] This paper is mainly concerned with the identification of a specific domain of laminin mediating the binding of leishmanial LBP The purified 67-kDa LBP isolated ... oligomerization of LBP is required for activating an associated tyrosine kinase The ability of L donovani LBP to bind a major ECM protein like laminin probably plays a role in pathogenesis of the disease...
  • 8
  • 420
  • 0
Báo cáo khoa học: A region within the C-terminal domain of Ure2p is shown to interact with the molecular chaperone Ssa1p by the use of cross-linkers and mass spectrometry doc

Báo cáo khoa học: A region within the C-terminal domain of Ure2p is shown to interact with the molecular chaperone Ssa1p by the use of cross-linkers and mass spectrometry doc

Ngày tải lên : 15/03/2014, 00:20
... consequence of the additional interaction between Ssa1p and the flexible N-terminal moiety of Ure2p, which is critical for assembly An alternative explanation that can account for this observation is that ... Detection of chymotryptic peptides modified by nondeuterated and deuterated cross-linkers by MALDI-TOF-TOF mass spectrometry A selection of mass spectra illustrates how the comparison of chymotryptic ... been established Ssa1p lysine 325 is not located within the client binding pocket of the chaperone Its lack of modification upon complex formation can only be attributed to a conformational rearrangement...
  • 12
  • 510
  • 0
My Own Kind Of Freedom potx

My Own Kind Of Freedom potx

Ngày tải lên : 15/03/2014, 15:20
... activities at once, and that's just what it meant when his belt buckle started vibrating Gorram them anyway; this better be important He got up from his desk, stretched, put on his jacket, and made his ... feds—that is, Alliance Security—that I've never heard of? " "What sort of branch?" "Doing what you did with military intelligence?" "Very good So, what are you doing here, at just the time you want to ... still on." "So you enlisted as an idealist." "Actually, I enlisted as a private." "Out of a sense of conviction Because of the cause." "Ugh If you want to put it that way." "What would you call it,...
  • 186
  • 830
  • 0
The Social Responsibility of Business is to Increase its Profits pot

The Social Responsibility of Business is to Increase its Profits pot

Ngày tải lên : 15/03/2014, 20:20
... employees for this social purpose? What is his appropriate share and what is the appropriate share of others? And, whether he wants to or not, can he get away with spending his stockholders', ... to spend it? He is told that he must contribute to fighting inflation How is he to know what action of his will contribute to that end? He is presumably an expert in running his company in producing ... interests of the corporation or that is required by law in order to contribute to the social objective of improving the environment Or that, at the expense of corporate profits, he is to hire...
  • 6
  • 459
  • 0
Báo cáo khoa học: Lysosomal localization of GLUT8 in the testis – the EXXXLL motif of GLUT8 is sufficient for its intracellular sorting via AP1- and AP2-mediated interaction docx

Báo cáo khoa học: Lysosomal localization of GLUT8 in the testis – the EXXXLL motif of GLUT8 is sufficient for its intracellular sorting via AP1- and AP2-mediated interaction docx

Ngày tải lên : 16/03/2014, 02:20
... lysates of rat brain (A) and HEK293 cells (B), clathrin-coated vesicle membranes enriched from rat brains (C), and lysates from mouse testis (D) The recombinant wild-type or mutated N-terminus of ... accumulated at the plasma membrane in cells depleted of either AP2 or clathrin (Fig 5B) These data indicate that sorting of GLUT8 to lysosomes occurs via adaptor complex mediated mechanisms involving ... hypothesis is correct, one would also expect to detect alterations in the steady-state distribution of GLUT8 in siRNA-treated cells We thus examined the effect of AP or clathrin downregulation...
  • 15
  • 508
  • 0
13C–18O bonds in carbonate minerals: A new kind of paleothermometer ppt

13C–18O bonds in carbonate minerals: A new kind of paleothermometer ppt

Ngày tải lên : 22/03/2014, 18:20
... through later geological history raises a separate and more complicated set of questions: First, if carbonate grows at low temperature and is then heated without re-crystallization, at what temperatures ... standard deviation for D47 of 0.64 ± 0.02; the precision of these data is indistinguishable from the expected limits from counting statistics (± 0.02– 0.03 for these data) These data indicate that long-term ... it is rigorously defined based only on measurements of the isotopic content of carbonate minerals That is, it is independent of the isotopic composition of water from which carbonate grew, or of...
  • 18
  • 472
  • 0
Báo cáo khoa học: Phagocytosis of bacteria is enhanced in macrophages undergoing nutrient deprivation ppt

Báo cáo khoa học: Phagocytosis of bacteria is enhanced in macrophages undergoing nutrient deprivation ppt

Ngày tải lên : 23/03/2014, 04:21
... engulfment of bacteria Our findings suggest that the role of the autophagy machinery is limited to the maturation of the phagosome and that it does not participate in the initial internalization of bacteria ... strong phosphorylation of p38 (Fig 6D), although without stimulating the uptake of heat-inactivated E coli (Fig 6E) We therefore concluded that enhanced phagocytosis of bacteria is not a general ... in the phagocytosis of E coli after induction of autophagy is unlikely because TLR4 is down-regulated in starved J774A.1 cells (Fig 2A) Moreover, phagocytosis of heat-inactivated E coli was unaltered...
  • 14
  • 344
  • 0

Xem thêm